1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
15

How many valance are transferred from the nitrogen atom to potassium in the formation of the compound potassium nitride?

Chemistry
2 answers:
never [62]3 years ago
5 0
3 valence electrons are transferred in the formation of the compound potassium nitride because nitrogen needs 3 valence electron to become stable, or to have the electron configuration of noble Gases. 
yulyashka [42]3 years ago
3 0
Nitrogen requires 3 electrons to have a total of 8 valence electrons.Each potassium atom will transfer one electron.A total of 3 potassium atoms and one nitrogen atom will be involved  in the  formation of a formula unit of potassium nitride.
You might be interested in
What does the color red means
Luden [163]
Danger, or some people look at it as love 
3 0
3 years ago
Read 2 more answers
A certain compound was found to have the molecular formula C5H12O2. To which of the following compound classes could the compoun
IgorC [24]

Answer : The given compound belongs to ether and alcohol.

Explanation :

The chemical formula of the given compound is, C_5H_{12}O_2

First we have to calculate the degree of unsaturation.

Formula used:

Degree of unsaturation = \frac{2C+2+N-X-H}{2}

where,

C = number of carbon

H = number of hydrogen

N = number of nitrogen

X = number of halogen

Degree of unsaturation = \frac{2\times 5+2+0-0-12}{2}=0

The degree of unsaturation is, 0 that means there is no double or triple bond in the compound only single bond is present between the atoms.

Thus, the given compound belongs to ether and alcohol.

6 0
3 years ago
Which criteria are responsible for deciding whether a heterogeneous mixture is a colloid or a suspension?
gayaneshka [121]
I believe the criteria responsible for deciding whether a heterogeneous mixture is a colloid or a suspension is whether the <span>particles remain suspended for an extended period of time. I hope it helps you.</span>
8 0
3 years ago
Read 2 more answers
How many atoms would be contained in 454 grams of iron?
aliina [53]

Answer:

4.90 x 10 24 atoms

Explanation:

the 24 is the exponent for the 10

5 0
3 years ago
What will happen to the flow of blood in blood vessels (pulse) if heart beat rate increase
PSYCHO15rus [73]

Answer:

"Low levels of the hormone epinephrine, also called<em><u> adrenaline</u></em>, cause blood vessels to relax and widen. High levels of this same hormone, along with the hormone norepinephrine, cause the blood vessels to narrow and the heart rate to rise, <u><em>increasing blood pressure</em></u>."

Explanation:

5 0
3 years ago
Other questions:
  • If you have 110.0 grams of an unknown compound that contains 12.3 grams of hydrogen, what is the percent by mass of hydrogen in
    11·2 answers
  • What type of indications would be shown if an igneous rock cooled quickly?
    13·1 answer
  • When you have analyzed your data and you form a _____________ ?
    7·1 answer
  • What is the purpose of subscripts in chemical formulas
    8·1 answer
  • Gastric juices have a pH of 1 or 2. This would indicate which of the following?
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Consider a voltaic cell where the anode half-reaction is Zn(s) → Zn2+(aq) + 2 e− and the cathode half-reaction is Sn2+(aq) + 2 e
    11·1 answer
  • What contribution did john dalton make to chemistry?
    10·1 answer
  • If a scientist has 24 grams of CH4, what is the theoretical yield of CO2 that can be produced?
    12·1 answer
  • Sorry for asking for too much but me needs helppppp
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!