Answer:
1+1=2 Unless this is a trick question. Then it's most likely 11.
Explanation:
While staying in the same period, if we move from left to right across the period, the atomic radius decreases. The reason is, in a period the number of shells remain the same and the number of electrons and protons increase as we move across the period to the right. The increased electrons and protons attract each other with greater force and hence the atomic size decreases.
So the element on the left most will have the largest atomic radius. So the correct ans is Potassium. Potassium will have the largest atomic size among Potassium, Calcium and Scandium.
Answer:
B: circulatory system
Explanation:
The circulatory system is made up of blood vessels that carry blood away from and towards the heart. Arteries carry blood away from the heart and veins carry blood back to the heart. The circulatory system carries oxygen, nutrients, and hormones to cells, and removes waste products, like carbon dioxide.
c) the salt solubility decreases with temperature.
Salts usually dissolve in water at a given temperature. When water cannot dissolve anymore salt at that same temperature, it is known as a saturation point. With most substances the solubility increases with increase in temperature. Same is the case for a salt like potassium nitrate. With increase in temperature the ability of it to dissolve in water increases. And so with decrease in temperature, the solubility decreases.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
