1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
13

Jonathan is working in his basement on a science fair project when his little sister closes and locks the door. Jonathan wants t

o let his parents know that he is stuck down in the basement. He can either yell as loudly as he can, bang on the metal pipes, or bang on the concrete wall. Which should he do if he wants someone to hear him? Explain your answer, and explain why the other options would not be as effective.
Chemistry
1 answer:
jeyben [28]3 years ago
8 0

Answer:

i think its metal pipes

Explanation:

sorry if im wrong

You might be interested in
READING CHECK
Wittaler [7]
Gas particles are in constant motion, and any object in motion has kinetic energy (Ek). ... For example, in the collision of two molecules, one molecule may be deflected at a slightly higher speed and the other at a slightly lower speed, but the average kinetic energy does not change.
GIVE ME POINTSSSSSSSSSS
3 0
3 years ago
2Ni(OH) → Ni2O + H2O <br> How many moles of water forms from 4.20 mol of nickel (I) hydroxide?
butalik [34]

Answer:

2.1 moles of water formed.

Explanation:

Given data:

Moles of water formed = ?

Moles of Ni(OH) = 4.20 mol

Solution:

Chemical equation:

2Ni(OH)    →  Ni₂O + H₂O

Now we will compare the moles of Ni(OH)  with water.

             Ni(OH)           :            H₂O

                2                 :              1

              4.20             :            1/2×4.20 = 2.1 mol

2.1 moles of water formed.

5 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
In ionic bonding, atoms__.
Nutka1998 [239]
In ionic bonding, atoms SHARE ELECTRONS
8 0
3 years ago
2. Why was it important to examine both the color and the streak of your minerals? Think about streak and explain why it’s calle
Delicious77 [7]
It is important to examine both the colour and the streak of a mineral because the streak may be completely different from the colour of the hand specimen.
The streak of a mineral is the color it possesses after it has been grounded to a fine powder. The streak test has to be done on minerals because it is a more reliable way of identifying a mineral with its color.<span />
8 0
4 years ago
Other questions:
  • Tell why small droplets of water on an oily surface are almost spherical.
    14·1 answer
  • 4. Describe in detail the relationship between chemical bonds and energy. What must be true of the bonds for a reaction to be en
    9·1 answer
  • Solid sodium reacts violently with water, producing heat, hydrogen gas, and sodium hydroxide. How many liters of hydrogen gas ar
    11·1 answer
  • How many underwater volcanoes erupt every year??? HELP
    14·1 answer
  • How many protons does Mg²₊ have?
    13·1 answer
  • Substances which will glow in the dark after being exposed to sunlight are:
    15·1 answer
  • How many total atoms are in 0.75 moles of CO2
    13·1 answer
  • Pls help me I’m confused of what candy this is
    12·1 answer
  • 20.8 grams of ethanol (CH3CH2OH) was burned in a calorimeter containing 200.0 grams of water. If the
    9·1 answer
  • Why do we need to clamp the rubber tube when we are transferring the flask from the boiling water to the cool water
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!