1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marissa [1.9K]
4 years ago
13

Which of the following is a major difference between lactic acid and alcohol fermentation?

Chemistry
1 answer:
pishuonlain [190]4 years ago
6 0

Both lactic acid and alcoholic fermentation begin with pyruvic acid and nadh. they are anaerobic processes that result in the production of energy in the absence of oxygen. So basically the two differences are that one makes ethanol and one makes lactic acid, and the other is that they are made by different species.


Alcohol fermentation requires aerobic conditions, while lactic acid fermentation requires anaerobic conditions.

You might be interested in
What is FeBr3 compound name?
inessss [21]
Iron bromide. Iron bromide (FeBr3)
3 0
3 years ago
Read 2 more answers
The average weather conditions over a long period of time is known as
frosja888 [35]

Answer: it’s climate

Explanation:

5 0
3 years ago
Now let’s return to the question of why everything went off when the light, a heater, and a hair dryer were all running in the b
igomit [66]

Answer:

The power must have gone out for that area.

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following is true about metallic bonds?
nlexa [21]

Answer:

D: electrones are delocalized

7 0
3 years ago
What is the principle role of a tower within a cellular system?
Crazy boy [7]
B.To transmit signals first it got to reach the antennas thingys to send the signal thats how we get our data and wifi on our phones
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the systematic name of PbO?
    15·2 answers
  • What is the empirical formula for a compound that contains 0.0134 g of iron, 0.00769 g of
    13·1 answer
  • A chemist analyze an unknown liquid .the chemist takes samples from the top ,middle and bottom of the samples .what observations
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Chemical bonding ranges from even electron sharing to total electron transfer because
    11·1 answer
  • The element thallium is 70% thallium-205 and 30% thallium-203. Calculate its relative atomic mass to 1 decimal place.
    14·1 answer
  • Can someone help me
    11·1 answer
  • How many moles are equal to 89.23 g of calcium nitrate?
    6·1 answer
  • Alkenes can be hydrated via the addition of borane to yield alcohols with non-Markovnikov regiochemistry.
    10·1 answer
  • What is the mass of chlorine if it has a volume of 68.78 mL and a density of 3.16g/L
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!