1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
3 years ago
5

I need help with this

Biology
1 answer:
alukav5142 [94]3 years ago
5 0

1.) Metaphase

2.) Prophase

3.) Telophase

4.) Interphase

5.) Interphase

6.)Interphase

7.) Anaphase

8.) Interphase

9.) Anaphase

10.) Interphase

11.) Metaphase

12.) Telophase

13.) Interphase

14.) Prophase

15.) Interphasse

16.) Interphase

17.) Metaphase

18.) Interphase

You might be interested in
Which genotype does pq represent in the Hardy-Weinberg equation?
Verizon [17]

Answer:

option A is 100% correct

6 0
3 years ago
Read 2 more answers
Which life process is classified as autrophic in some organisms and heterophic in other organisms
Tatiana [17]

Answer:

distanced from between

Explanation:

speed

4 0
3 years ago
Which of the following is not a specialized tissue found in plants?
Helen [10]
Adipose - human fat.
8 0
2 years ago
?in learning, the basal ganglia ____. ?integrates information over many trials is involved in the development of flexible respon
Tom [10]
The correct answer would be the first option. The basal ganglia integrates information over many trials. It is the one responsible for the voluntary motor control, eye movement, emotional and cognitive functions and procedural learning. It is found at the base of the forebrain.
4 0
3 years ago
_________ cells produce granules that secrete a lipid-rich product that help make the skin waterproof
Anestetic [448]

Answer:

keratinocytes

Explanation:

The skin contains various types of cells like melanocytes, keratinocytes and Langerhans cells. The Keratinocytes constitute about 90% of the human skin and are mostly present in the basal skin.

The keratinocytes produce keratin protein which protects the skin and some keratinocytes contain keratohyalin granules which are filled with cysteine-rich and histidine-rich proteins. The keratin and these granules make the skin waterproof.

Thus, keratinocytes are the correct answer.

4 0
3 years ago
Other questions:
  • DNA strand: TTTTCGCGATATGCTGGT The following set of protein chains (amino acids) were created by mutating one nucleotide in the
    11·1 answer
  • Infections arising from the periapical region of the mandibular first premolars perforate through the lingual cortex to theA- Pt
    8·2 answers
  • What forms when freshwater meets with the ocean??
    11·1 answer
  • How does food provide a source of energy for living things ?
    8·1 answer
  • A substance is very sour and has a ph of 4. what color would you expect it to turn a piece of litmus paper
    6·1 answer
  • Energy in an organism is called what?
    15·1 answer
  • What can rapidly pass directly through the phospholipids of the plasma membrane
    6·1 answer
  • BRAINLIEST <br>Why would coming to land be an advantage to early amphibians?
    15·1 answer
  • I need help on 14 please
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!