1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
14

Calculate the molarity of 139 grams of sucrose, C12H22O11, in 2.60 liters of solution.

Chemistry
1 answer:
Allisa [31]3 years ago
4 0

Answer:

to calculate the molarity of the said sucrose,

firstly calculate the moles

which is = Molecular weight of C12H22O11 = 342g/mol

then

moles = 139/342

= 0.41 moles

to calculate Molarity now

Molarity= moles of the solute/volume of solution in liter

=0.41/2.60

=0.158M

Explanation:

You might be interested in
For the following exothermic reaction, A+B⇌C+D + Heat, if the temperature is increased, the reaction will experience a shift to
Elodia [21]
(Left) I’m pretty sure
6 0
3 years ago
If 0.500 mol of NaN3 react what mass I'm grams of nitrogen would result
klemol [59]
Looks like 3*.5 mol of N, or 1.5*.5 N2 
<span>convert that to grams.</span>
6 0
3 years ago
Which of the following is true for balancing equations?
algol [13]

Answer:

A.

Explanation:

An equation with the equal amount and proportion of atoms of each element on both sides of the reaction is commonly referred to as a balanced chemical equation.

The law of conservation of matter asserts that no observable and empirical change in the amount of matter occurs within a conventional chemical process. As a result, each element in the product would have the same equal amount or numbers of atoms as the reactants.

5 0
3 years ago
Draw all the structural isomers for the molecular formula C3H8O. Be careful not to draw any structures by crossing one line over
Art [367]

Answer:

The three isomers having the molecular formula C_{3} H_{8}O are drawn in the figure below.

Explanation:

5 0
3 years ago
What is a cold front
Vlada [557]
A cold front is the leading edge of a cooler mass of air, replacing at ground level a warmer mass of air, which lies within a fairly sharp surface trough of low pressure.
4 0
3 years ago
Read 2 more answers
Other questions:
  • C12H22O + 11 H2SO4 → 12 C + 11 H2SO4 + 11 H2O.
    12·1 answer
  • At constant pressure, which of these systems do work on the surroundings? Check all that apply.
    13·1 answer
  • Can someone help me answer this ASAP!! thank you!
    15·2 answers
  • The boiling point of acetone is much greater than the boiling point of 2-methylpropane.
    5·1 answer
  • PLS ANSWER FAST AHAH<br><br> distilled water is a pure substance <br> true or false ?
    12·1 answer
  • Motion is produced by
    14·1 answer
  • Boron trifluoride gas is collected at in an evacuated flask with a measured volume of . When all the gas has been collected, the
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Question 8 (3 points) What is the formula for Silver (III) sulfide? O Ag2(SO4)3 O Ag3(SO4)2 Ag3S2 Ag2S3​
    11·1 answer
  • A central atom has two lone pairs on opposite sides and four single bonds. What is the molecule geometry of the result?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!