All categories

3 years ago

Carbon-13 is an isotope of carbon. The atomic number of carbon is 6. How many neutrons does carbon-13 have?

Chemistry

2 answers:

atroni [7]3 years ago

8 0

Answer:

think the answer is 13

Explanation:

dimulka [17.4K]3 years ago

5 0

Neutrons = mass no. - atomic no. Therefore depending on your periodic table (mine says 12 for mass number) so you do (mass no. - 6 = 6 or 7 ) depending again if you use 12 or 13

You might be interested in

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

2 years ago

Using the following standard reduction potentials, Fe3+(aq) + e- → Fe2+(aq) E° = +0.77 V Ni2+(aq) + 2 e- → Ni(s) E° = -0.23 V ca

lina2011 [118]

Answer: The above reaction is non-spontaneous.

Explanation:

For the given chemical reaction:

$Ni^{2+}(aq.)+2Fe^{2+}(aq.)\rightarrow 2Fe^{3+}(aq.)+Ni(s)$

Here, nickel is getting reduced because it is gaining electrons and iron is getting oxidized because it is loosing electrons.

We know that:

$E^o_{(Fe^{3+}/Fe^{2+})}=0.77V\\E^o_{(Ni^{2+}/Ni)}=-0.23V$

Substance getting oxidized always act as anode and the one getting reduced always act as cathode.

To calculate the $E^o_{cell}$ of the reaction, we use the equation:

$E^o_{cell}=E^o_{cathode}-E^o_{anode}$

$E^o_{cell}=-0.23-0.77=-1.0V$

Relationship between standard Gibbs free energy and standard electrode potential follows:

$\Delta G^o=-nFE^o_{cell}$

As, the standard electrode potential of the cell is coming out to be negative for the above cell. Thus, the standard Gibbs free energy change of the reaction will become positive making the reaction non-spontaneous.

Hence, the above reaction is non-spontaneous.

3 0

3 years ago

Write the electron configuration for N and N-3. How many electrons are in the valence energy level?

Alinara [238K]

Non-valence electrons: 1s22s22p6. Therefore, we write the electron configuration for Na: 1s22s22p63s1. What is the highest principal quantum number that you see in sodium's electron configuration? It's n = 3, so all electrons with n = 3 are valence electrons, and all electrons with n < 3 are non-valence electrons.

8 0

3 years ago

10 points please please help

Inga [223]

Your answer would be respiration. This would be your answer because, plants take in carbon dioxide, and animals, including humans, breath oxygen. I hope this had helped you out.

4 0

3 years ago

kompoz [17]

Answer:

10-10 above the 0 is positive and the ones below is - (negitive)

Explanation:

4 0

3 years ago