All categories

3 years ago

How dose a greenhouse allow plants to be grown in the cold winter months?

Chemistry

2 answers:

tiny-mole [99]3 years ago

8 0

By air conditioning, heating, and of course the glass for the sun :3

user100 [1]3 years ago

3 0

Insulation, and heating, the sun does help on occasion but yeah.

You might be interested in

Heated bricks or blocks of iron were used long ago to warm beds. A 1.49 -kg block of iron heated to 155 Celsius would release ho

AlekseyPX

Specific heat capacity= Quantity of heat/massxΔT
Shc of iron (constant)= 0.4494J/³C for 1g
1.49kg=1490g
Q=1490x(22-155)x0.4494
Q=<span>89057.598J</span>

6 0

3 years ago

What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

3 years ago

A cylindrical grain has a base radius of 5m. the surface area is 1099m^2. What is the height of the bin to the nearest metre?

Inessa05 [86]

The height of the bin is 29.9m.

The quantity of space enclosing a three-dimensional shape's exterior is its surface area.

The total surface area of the cylinder formula is simply the sum of the base surface area and the lateral surface area.

The radius of the cylinder, r = 5m

Surface area = 1099 m²

∴ A = 2πrh + 2πr²

$h = \frac{A- 2\pi r^2}{2\pi r}$

$h = \frac{1099- 2 (3.141) 5^2}{2 (3.141) 5}$

$h = \frac{1099- 157.05}{31.41}$

$h = \frac{941.95}{31.41}$

$h = 29.9 m$

Therefore, the height of the bin is 29.9m.

Learn more about surface area here:

brainly.com/question/76387

#SPJ4

5 0

1 year ago

Is ice melting in a drink a chemical change?

konstantin123 [22]

Nope, it's a physical change. When ice melts it changes into liquid water, it's still water. Changes in which no new substances are formed are physical changes, hence this is a physical change.

6 0

3 years ago

How do you find the volume of a liquid

mart [117]

Today they will practice measuring different liquids. They will use a container called a graduated cylinder to measure liquids. Graduated cylinders have numbers on the side that help you determine the volume. Volume is measured in units called liters or fractions of liters called milliliters (ml).

7 0

3 years ago