1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
8

Which formula represents a polar molecule? (1) Br2 (3) CH4 (2) CO2 (4) NH3

Chemistry
1 answer:
ollegr [7]3 years ago
8 0
The formula representing a polar molecule is (4) NH3, for the difference in electronegativity of Nitrogen (N) and Hydrogen (H) is large, and thus it is polar.

Hope this helps~
You might be interested in
If I have 0.070 moles of gas at a pressure of 0.20 atm and at a temperature of 8.00°C,
Ivanshal [37]

Answer:

PV=nRT

0.20×v = 0.070×8.00

0.20V= 0.56

0.20v÷0.20v = 0.56÷0.20v

= 2.8

3 0
3 years ago
]Which of the following describes the arrangement of particles in plasma?The particles are ionized and move independently of eac
Ugo [173]
The arrangement of the particles in a plasma would be that the particles are ionized and move independently of each other. Plasma is also called an ionized gas where it has free charged particles and are moving regardless of each other.
4 0
3 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Compare amplitudes, wavelengths, and frequencies of waves
mr_godi [17]

Answer:

The answer is option b.

Explanation:

Amplitude is the distance apart each wave is.

8 0
2 years ago
A molecular orbital that decreases the electron density between two nuclei is said to be ____.
nikklg [1K]

A molecular orbital that decreases the electron density between two nuclei is said to be <u>antibonding.</u>

The bonding orbital, which would be more stable and encourages the bonding of the two H atoms into H_{2}, is the orbital that is located in a less energetic state than just the electron shells of the separate atoms. The antibonding orbital, which has higher energy but is less stable, resists bonding when it is occupied.

An asterisk (sigma*) is placed next to the corresponding kind of molecular orbital to indicate an antibonding orbital. The antibonding orbital known as * would be connected to sigma orbitals, as well as antibonding pi orbitals are known as \pi* orbitals.

Therefore,  molecular orbital that decreases the electron density between two nuclei is said to be <u>antibonding.</u>

<u></u>

Hence, the correct answer will be option (b)

<u />

To know more about molecular orbital

brainly.com/question/13265432

#SPJ4

<u />

<u />

6 0
2 years ago
Other questions:
  • Express your answer using two significant figures.<br><br><br> 2.7 cm3 = m3<br><br> 2.0 mm3= m3
    5·1 answer
  • What part of an atom bonds with other atoms
    13·2 answers
  • Different environments cause different species to __________.
    8·2 answers
  • What is the molarity of a CaCl2 solution containing 330 grams of CaCl2 in 1 liter of solution?
    9·1 answer
  • Which of the following is not organic?
    9·1 answer
  • 1)
    8·1 answer
  • ILL GIVE THE BRAINLIST HELP ME ASAP
    9·1 answer
  • The big bang theory suggests that the origin of the universe began with
    6·1 answer
  • Which phase change is the opposite of boiling?
    10·1 answer
  • What was boyle’s most famous discovery about gases?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!