1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
4 years ago
6

A pure substance is found to be a good conductor of electricity in both its solid and liquid

Chemistry
1 answer:
EastWind [94]4 years ago
4 0
The answer is a)ionic
You might be interested in
If you can run 3 miles in 19 minutes. What is your pace in kilometers per hour?
Norma-Jean [14]

Answer:

10.1389

Explanation:

5 0
3 years ago
How many molecules are there in 4.00 moles of sulfur dioxide?
FinnZ [79.3K]

Explanation:

4 x 6.02 x 10²³ = 2.41 x 10²⁴

5 0
3 years ago
Using the following equation 5KNO2+2KMnO4+3H2SO4=5KNO3+2MnSO4+K2SO4+3H20. Starting with 2.47 grams of KNO2 and excess KMnO4 how
Aleonysh [2.5K]

Given equation : 5KNO_{2} + 2KMnO_{4} + 3H_{2}SO_{4}\rightarrow 5KNO_{3} + 2MnSO_{4} + K_{2}SO_{4} + 3H_{2}O

Given information = 2.47 grams KNO2 and excess KMnO4 and we need to find grams of water (H2O).

Since KMnO4 is in excess, so grams of water(H2O) can be calculated using grams of KNO2 with the help of stoichiometry.

To find grams of water(H2O) from grams of KNO2 , we need to follow three steps.

Step 1. Convert 2.47 grams of KNO2 to moles of KNO2.

Moles = \frac{grams}{molar mass}

Molar mass of KNO2 = 85.10 g/mol

Moles = 2.47 gram KNO2\times \frac{1 mol KNO2}{85.10 gram KNO2}

Moles = 0.0290 mol KNO2

Step 2. Convert moles of KNO2 to moles of H2O using mole ratio.

Mole ratio are the coefficient present in front of the compound in the balanced equation.

Mole ratio of KNO2 : H2O is 5 : 3 (5 coefficient of KNO2 and 3 coefficient of H2O)

0.0290 mol KNO2\times \frac{3 mol H2O}{5 mol KNO2}

Mole = 0.0174 mol H2O

Step 3. Convert mole of H2O to grams of H2O

Grams = Moles X molar mass

Molar mass of H2O = 18.00 g/mol

Grams = 0.0174 mol H2O\times \frac{18 g H2O}{1 mol H2O}

Grams of water = 0.313 grams H2O

Summary : The above three steps can also be done in a singe setup as shown below.

2.47 gram KNO2\times \frac{(1 mol KNO2)}{(85.10 gram KNO2)}\times \frac{(3 mol H2O)}{(5 mol KNO2)}\times \frac{(18.00 gram H2O)}{(1mol H2O)}

In the above setup similar units get cancelled out and we will get grams of H2O as 0.313 grams water (H2O)

8 0
4 years ago
PLEASE HELP ASAP!!! science
Ksju [112]

Answer:

It's the oesophagus.

Explanation:

The worm digestive system consists of the pharynx, the esophagus, the crop, the intestine and the gizzard. The oesophagus is not mentioned. Thus, it's not part of the worm digestive system.

8 0
3 years ago
Read 2 more answers
Name three ways in which unicellular organisms can move. Describe one of them.
Viefleur [7K]

Answer:

Unicellular organisms achieve locomotion using cilia and flagella. By creating currents in the surrounding environment, cilia and flagella can move the cell in one direction or another.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Controls are defined as____
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What does an atomic number represent in an atom?
    10·1 answer
  • A solution contains 42.0 g of heptane (C7H16) and 50.5 g of octane (C8H18) at 25 ∘C. The vapor pressures of pure heptane and pur
    11·1 answer
  • The reduction potential (E0′) of a substance reflects its tendency to donate or accept electrons. The larger the difference (ΔE0
    11·1 answer
  • Please help with these questions ASAP will give brainlist!! CHEMISTRY
    7·1 answer
  • If the elements W, X, Y, and Z have electronegativity values of 1.0, 2.0, 2.5, and 3.5, respectively, which bond is the least po
    5·1 answer
  • Where my Todoroki fans at?
    11·1 answer
  • How many mL of 2.5 M K2SO4 are required to obtain 1.25 grams of the compound?
    6·1 answer
  • Select the correct answer.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!