1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
3 years ago
7

Which is true about a chemical reaction

Chemistry
2 answers:
victus00 [196]3 years ago
8 0
I think A. is the answer
aleksandrvk [35]3 years ago
4 0
The answer is A :)
Your welcome
You might be interested in
Why do we have robots?
spayn [35]

The world needs robots for a countless number of reasons, including hazardous jobs and automated manufacturing. Robots work without breaks or the need to sleep or eat, allowing manufactures to streamline processes and improve output. Robots are employed in roles ranging from cleaning up dangerous waste and chemical spills to disarming bombs and protecting soldiers in the field. New, humanoid robots and "exo-suits," originally designed for military use, are now being developed in the private sector for uses ranging from manual labor to helping those with handicaps and mobility issues.

Robots also provide a level of precision that is unmatched by the human hand, and one which is repeatable over indefinite time frames. These characteristics make them ideal for precision cutting, welding and assembly processes. Robots are also revolutionizing medical procedures, allowing many types of surgery to be performed with non-invasive, out-patient procedures, as opposed to traditional procedures requiring longer recovery times. Medical robots are now so advanced that they are being employed in brain, heart and eye surgeries, allowing doctors to treat conditions that were previously only possible through treatments nearly as dangerous as the offending condition.


7 0
3 years ago
Read 2 more answers
A student described two properties of a substance as shown.
AnnZ [28]

Answer:

X is a chemical property and Y is a physical property.

Explanation:

i did it.

3 0
3 years ago
A solution is prepared by dissolving 0.7234 g oxalic acid (H2C2O4) in enough water to make 100.0 mL of solution. A 10.00-mL aliq
marishachu [46]

Answer: The final molarity of the diluted oxalic acid solution is 0.0032 M

Explanation:

Molarity: It is defined as the number of moles of solute present per liter of the solution.

Formula used :

Molarity=\frac{n\times 1000}{V_s}

where,

n= moles of solute

Moles=\frac{\text{Given mass}}{\text{Molar mass}}=\frac{0.7234g}{90g/mol}=0.008moles

V_s = volume of solution in ml

Molarity=\frac{0.008\times 1000}{100.0}=0.08

To calculate the final molarity of the diluted oxalic acid solution

M_1V_1=M_2V_2

where,

M_1\text{ and }V_1 are the molarity and volume of concentrated oxalic acid solution.

M_2\text{ and }V_2 are the molarity and volume of diluted oxalic acid solution.

We are given:

M_1=0.08\\V_1=10.00mL\\M_2=?\\V_2=250.0mL

Putting values in above equation, we get:

0.08\times 10.00=M_2\times 250.0\\\\M_2=0.0032M

Thus the final molarity of the diluted oxalic acid solution is 0.0032 M

8 0
3 years ago
4.91 M NaOH solution (density=1.04g/ mL)
hodyreva [135]
Uhhhhhhhhhh................
6 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Other questions:
  • Find the volume of a rock made out sandstone with a density of 2.4 g/cm^3 and a mass of 8.5g.
    9·1 answer
  • Air containing 0.06% carbon dioxide is pumped into a room whose volume is 12,000 ft3. The air is pumped in at a rate of 3,000 ft
    5·1 answer
  • Help please-
    15·1 answer
  • According to the following reaction, how many grams of hydrofluoric acid will be formed upon the complete reaction of 25.6 grams
    14·1 answer
  • Which element is oxidized in the following reaction: 2FeCl₂ + Cl₂→2FeCl₃ if Fe goes from + 2 to +3 and Cl goes from 0 to −2?
    5·1 answer
  • Latitude plays a major role in determining the climate, or long-term weather patterns, of an area. Because of differences in the
    14·1 answer
  • Biologists classify all living things into __ kingdoms.<br> A.five<br> B.three<br> C.six<br> D.seven
    10·2 answers
  • How does the potential-energy diagram for a reaction indicate whether the reaction is endothermic or exothermic?
    7·2 answers
  • Based on this information, do you think that the mole should be considered a base unit in the Sl system? Explain why or why not.
    5·1 answer
  • Does the ir spectrum allow you to confirm that the structure of the product is a combination of the two reactants?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!