1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mkey [24]
3 years ago
11

Refrigerators are usually kept at about 5°C, while room temperature is about 20°C. if you were to take an empty sealed 2 liter s

oda bottle at room temperature and place it in the fridge, would you expect it to contact to one fourth it's original volume? options.
(a) yes, because 5 is one fourth of 20.
(b) No, because there is no gas inside the bottle.
(c) No, because Celsius is not an absolute temperature scale.
Chemistry
1 answer:
MakcuM [25]3 years ago
8 0

Answer:

c) No, because Celsius is not an absolute temperature scale

Explanation:

converting  5 oC to kelvin which is the absolute temperature scale gives = 273 + 5 = 278 K

and converting 20 oC to kelvin = 20 + 273 = 293 K

the ratio = 278 / 293 = 0.94 approx 1 not 4

You might be interested in
What is the molarity (M) of .5 liter of a solution that has 205 g of NaCl dissolved in it?
jeka94

Answer:

<h2>Molarity = 7 mol / L</h2>

Explanation:

Since the mass of NaCl and it's volume has been given we can find the molarity by using the formula

<h3>C =  \frac{m}{M \times v}</h3>

where

C is the molarity

m is the mass

M is the molar mass

v is the volume

From the question

v = 0.5 L

m = 205 g

We must first find the molar mass and then substitute the values into the above formula

M( Na) = 23 , M( Cl) = 35.5

Molar mass of NaCl = 23 + 35.5 =

58.5 g/mol

So the molarity of NaCl is

C =  \frac{205}{0.5  \times 58.5}  \\ C =  \frac{205}{29.25}

C = 7.00854

We have the final answer as

<h3>Molarity = 7 mol / L</h3>

Hope this helps you

8 0
3 years ago
How much energy was absorbed by the water?
Lorico [155]
<h2>Answer: <u><em>Precisely, water has to absorb 4,184 Joules of heat (1 calorie) for the temperature of one kilogram of water to increase 1°C.</em></u></h2>

Explanation:

4 0
3 years ago
Read 2 more answers
Orange juice has a hydrogen ion concentration of approximately 10^-4. What is the pH of orange juice?
Yakvenalex [24]

A) 4

pH=-log[H+]

pH=-log(10^-4)

B) Weaker

pH of orange juice=4

pH of coffee=5

An acid with pH of 4 is stronger than a pH of 5

C) 7, neither/neutral

pH of water=7

5 0
3 years ago
The nucleus of most atoms is composed of<br>​
gulaghasi [49]

Answer:

protons

Explanation:

5 0
3 years ago
How many grams of sodium make up 4.01×10^25 atoms
alexgriva [62]

Answer:

  • 5.74 ×10 25

Explanation:

3 0
3 years ago
Other questions:
  • Which of the following substances has the characteristics shown in the chart? A. homogeneous mixture B. compound C. solution D.
    14·1 answer
  • 15 points for only two question :) please help
    15·1 answer
  • Which expression represents this word phrase?
    15·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following demonstrates a double-replacement reaction?
    8·2 answers
  • List two things you know about nonrenewable energy
    8·2 answers
  • How many liters of a 1.5 M solution can you make if you have .50 mol of KCl?
    9·1 answer
  • Recall how Newton's investigation of light followed one form of scientific method​
    13·1 answer
  • In the following reaction, if you wanted to produce more hydrochloric acid (HCl), what should you do? (2 points)
    5·1 answer
  • Why does it take less
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!