1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
6

152 dm^3 of gas has a pressure of 98.6 kpa. at what pressure will the volume be quartered

Chemistry
1 answer:
djverab [1.8K]3 years ago
6 0

Answer:

P₂ = 394.4 KPa

Explanation:

Given data:

Volume of gas = 152 dm³

Pressure of gas = 98.6 KPa

Final pressure = ?

Final volume = quartered = 1/4×152 = 38 dm³

Solution:

P₁V₁ = P₂V₂

P₂ = P₁V₁/V₂

P₂ = 98.6 KPa .  152 dm³ / 38 dm³

P₂ = 14987.2 KPa.  dm³ / 38 dm³

P₂ = 394.4 KPa

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
What is the pH of a 75.0 mL solution that is 0.045 M in weak base and 0.053 M in the conjugate weak acid
noname [10]

Answer:

7.07

Explanation:

HA = weak acid = 0.053

A+ = conjugate base = 0.045

Ka = 7.2x10^-8

Ka = [H+][A-]/HA

7 2x10^-8 = [H+][0.045]/0.053

[H+] = 7.2x10^-8 x 0.053/0.045

= 8.48x10^-8

PH = -log[H+]

= -log[8.48x10^-8]

PH = -[login.48 + log10^-8]

PH = -0.928 - (-8)log10

= 7.07

3 0
3 years ago
If objects at the same distance suddenly decreased in mass the gravitational force between them would
Flauer [41]

Answer:

Gravitational force is also decreases.

Explanation:

Gravitational force is directly proportional to the mass of an object and inversely properly to the distance between their centres. Directly means if one increases the other automatically increases or if one decreases, the other also decreases. There is a direct relationship between mass and gravitational force so if mass of the bodies decrease, the gravitational force is also decreases.

7 0
3 years ago
Which does not show earths past environment?<br><br> Please hurry I need this :((
ANTONII [103]
There’s no options!!
7 0
3 years ago
Describe how to prepare 10 ml of 5, 10, 15, and 20 micro M CV solution using a 25 microM CV stock solution
zalisa [80]
A calibration curve requires the preparation of a set of known concentrations of CV, which are usually prepared by dieting a stock solution whose concentration is known.
4 0
3 years ago
Other questions:
  • Which of the following is the correct Lewis structure diagram for Neon? The letters Ne with eight dots The letters Ne with seven
    5·2 answers
  • Which has the least gravitational potential energy?
    7·1 answer
  • According to its nutrition label, orange soda contains 49g of sugar per 355 ml serving. if the density of the beverage is 1.043
    11·1 answer
  • Q3. A student added water to calcium oxide to make calcium hydroxide
    14·1 answer
  • Which aqueous solution should form a precipitate with aqueous cu(no3)2? 1. kno3 2. cuso4 3. k2so4 4. k2s?
    14·1 answer
  • Which gas sample STP has the same total number of molecules at 2.0 L of CO2(g) at STP
    8·1 answer
  • What is CaF2(aq) + Rb
    8·1 answer
  • A student places three ice cubes in a beaker and allows them to partially melt. If she measures the temperature of the water in
    15·1 answer
  • Laticia draws the diagram below to show Earth’s magnetic field.
    7·2 answers
  • The list shows a number of common chemical substances. [5]
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!