Liquid silver is less dense than solid silver, so the solid silver would sink.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
It's b
Explanation:
I had the same exact question
The dissociation of formic acid is:
The acid dissociation constant of formic acid, 
is:
![k_a = \frac{[HCOO^{-}] [H^{+}]}{HCOOH}](https://tex.z-dn.net/?f=%20k_a%20%3D%20%5Cfrac%7B%5BHCOO%5E%7B-%7D%5D%20%20%5BH%5E%7B%2B%7D%5D%7D%7BHCOOH%7D%20%20%20%20%20)
Rearranging the equation:
![\frac{[HCOO^{-}]}{[HCOOH]} = \frac{k_a}{[H_+]}](https://tex.z-dn.net/?f=%20%5Cfrac%7B%5BHCOO%5E%7B-%7D%5D%7D%7B%5BHCOOH%5D%7D%20%3D%20%5Cfrac%7Bk_a%7D%7B%5BH_%2B%5D%7D%20)
pH = 2.75
![pH = -log[H^{+}]](https://tex.z-dn.net/?f=%20pH%20%3D%20-log%5BH%5E%7B%2B%7D%5D%20)
![[H^{+}]= 10^{-2.75} = 1.78 \times 10^{-3}](https://tex.z-dn.net/?f=%20%5BH%5E%7B%2B%7D%5D%3D%2010%5E%7B-2.75%7D%20%3D%201.78%20%5Ctimes%2010%5E%7B-3%7D%20)
Substituting the values in the equation:
![\frac{[HCOO^{-}]}{[HCOOH]} = \frac{1.78\times 10^{-4}}{1.78\times 10^{-3}}](https://tex.z-dn.net/?f=%20%5Cfrac%7B%5BHCOO%5E%7B-%7D%5D%7D%7B%5BHCOOH%5D%7D%20%3D%20%5Cfrac%7B1.78%5Ctimes%2010%5E%7B-4%7D%7D%7B1.78%5Ctimes%2010%5E%7B-3%7D%7D%20%20%20)
Hence, the ratio is 
.
beneath the oceanic crust and create magma where two tectonic plates meet at a divergent boundary.
