1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fiasKO [112]
3 years ago
6

If you were studying the effects of climate change on the geographic ranges of species living in the mountains and your climate

records showed that mean temperatures were increasing, which species would you be MOST concerned about from a conservation standpoint?
-a species that is a habitat generalist and lives at low elevations
-a species that is a habitat specialist and lives at the highest elevations
-a species that is a habitat specialist and lives at low elevations
-a species that is a habitat generalist and lives at middle elevations
-a species that is a habitat specialist and lives at middle elevations
Biology
1 answer:
Andrews [41]3 years ago
3 0

A species that is habitat specialist and lives at the highest elevation.

Explanation:

An ecosystem consist of plants, animals as well as micro-organisms but due to climate change the plants as well as animals are in danger . The case that has been provided in the question where due to climate change the temperature rises as a result the species living at the highest elevation are in problem .

Due to rise in temperature the snow is melting and the sea water level is rising. The animals and plants adapt themselves according to the climate where they are residing but suddenly if climatic change take place they will be unable to survive.

The animals which are mostly affected due to climatic change are snow leopard, polar bear, giant panda.  

You might be interested in
Whch lists correctly orders the outer planets from least to greatest from the sun
Mama L [17]

Answer:

The order of planets from closest to farthest from the Sun are Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus and Neptune. The largest planet is Jupiter, followed by Saturn, Uranus, Neptune, Earth, Venus, Mars and, the smallest planet, Mercury.

Explanation:

5 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Some homeostatic imbalances cause a variable that is normally controlled by negative feedback to be abnormally controlled by pos
tigry1 [53]

Answer:

True

Explanation:

Some deviations from normal homeostasis activate the positive feedback loops to control the conditions which are otherwise regulated by negative feedback mechanisms.

For example, the blood levels of respiratory gases and H+ ions are regulated by a negative feedback system via chemoreceptors. The increased partial pressure of carbon dioxide gas and lowered pH or lowered partial pressure of oxygen in the blood are sense by central and peripheral chemoreceptors which in turn activate the neurons of the dorsal respiratory group (DRG).

The activated DRG triggers an increased in the rate and depth of the breathing to facilitate the inhalation of more oxygen and exhalation of CO2 to restore the normal levels.  

However, hypocapnia inactivates the chemoreceptors and does not allow negative feedback to restore the normal CO2 levels in the blood.  

Under such conditions, the positive feedback loop stimulates the DRG neurons more strongly in response to the increased partial pressure of CO2 above the normal levels than when the partial pressure of oxygen falls below the normal level. These dangerously lowered oxygen levels may also cause fainting.  

5 0
4 years ago
Three interesting facts about nucleic acids
romanna [79]
1. Nucleic acids are the molecules that code the genetic information of organisms.

2. The two nucleic acids used in the repair, reproduction and protein synthesis are deoxyribonucleic acid (DNA, shown) and ribonucleic acid (RNA)

3. DNA and RNA are polymers made up of monomers called nucleotides
8 0
3 years ago
Identify two examples of environmental factors that may impact salivary peroxidase activity. Describe how each of the environmen
charle [14.2K]

Answer:

Examples of environmental factors that may alter salivary peroxidase include periodontitis, oral hygiene, presence of heavy metal ions, bacteria (e.g., <em>Streptococcus gordonii</em>), anaerobic conditions, temperature, pH, etc.

Explanation:

Peroxidase is an enzyme found in all aerobic cells that act to convert toxic hydrogen peroxide (H2O2) into dioxygen (O2) and water (H2O). This enzyme plays an important non-specific defensive role against proliferating micro-organisms that cause periodontal diseases such as periodontitis, which is a serious inflammatory disease affecting the tissues around the teeth. The most common environmental factors influencing the development of periodontitis include oral hygiene, smoking and age. In this regard, it has recently been shown that there is a positive correlation between salivary peroxidase activity and periodontal health, especially in non-smoker individuals. In consequence, it is expected that smoker individuals are more prone to suffer periodontal diseases by reduction of the salivary peroxidase levels.

7 0
3 years ago
Other questions:
  • Pharmacist are experts in medicine. Which branches of science do pharmacists need to know in order to do there job properly?
    5·2 answers
  • Picking up a book is a voluntary action.
    5·2 answers
  • A population of deer is separated by an emerging volcano. The two populations come back into contact 200 years later, but are in
    10·2 answers
  • What is the function of the mitochondria?
    10·1 answer
  • Should cloning humans be legal? That is a tough question to answer. Human cloning is a complex issue, and as in many complex iss
    15·2 answers
  • Can some one help with c which consumer is it?
    12·1 answer
  • Organism whose cell does not contain a nucleus
    11·1 answer
  • Anybody who helps me with this gets 10 brainly points.
    11·1 answer
  • What two numbers between 10 and 20 have 6 as their GCF
    9·1 answer
  • Which is part of the biogeochemical cycle?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!