1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
quester [9]
3 years ago
7

Toaster pops up knocks over ball what type of energy is that ?

Chemistry
1 answer:
Lynna [10]3 years ago
6 0
The type of energy is kinetic because the toaster was in motion before it knocked the ballover
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
2 years ago
Who's theory states that atoms are made up of empty space with electrons around a positively charged mass?
emmasim [6.3K]
That would be Rutherford's Theory.
5 0
2 years ago
How to revise in just 1 whole day for chemistry combined science is it possible to get a good grade
Pavlova-9 [17]

it will be hard, but you can do it. Just study given the materials for the course. Understand enthalpy and entropy, and various types of bonding and you'll be fine.

4 0
3 years ago
OT protons (d) (a) and (b)
insens350 [35]
<h2>b is the correct answer</h2>

according In my course I studying it all

6 0
3 years ago
Read 2 more answers
How many grams of CH4 will be in a 500ml contain at STP?
ArbitrLikvidat [17]

Answer:

Mass = 0.32 g

Explanation:

Given data:

Mass of CH₄ = ?

Volume of CH₄ = 500 mL (500 mL× 1L/1000 mL= 0.5 L)

Temperature = 273 K

Pressure = 1 atm

Solution:

Volume of CH₄:

500 mL (500 mL× 1L/1000 mL= 0.5 L)

The given problem will be solve by using general gas equation,

PV = nRT

P= Pressure

V = volume

n = number of moles

R = general gas constant = 0.0821 atm.L/ mol.K  

T = temperature in kelvin

By putting values,

1 atm× 0.5 L = n×0.0821 atm.L/ mol.K  × 273 K

0.5 atm.L = n×22.4 atm.L/ mol

n = 0.5 atm.L / 22.4 atm.L/ mol

n = 0.02 mol

Mass in gram:

Mass = number of moles × molar mass

Mass = 0.02 mol × 16 g/mol

Mass = 0.32 g

7 0
3 years ago
Other questions:
  • Suppose you held two magnets a short distance apart,then let go. what would happen?
    7·2 answers
  • A considerable amount of heat is required for the decomposition of aluminum oxide. 2 al2o3(s) â 4 al(s) + 3 o2(g) δh = 3352 kj
    6·1 answer
  • What colors would an artificial plant-growth light favor to promote plant growth effectively?
    13·1 answer
  • One of the reactions you observed resulted in this product: nacl + h2o + co2 (g)? what well did this reaction occur in? describe
    14·1 answer
  • ¿Cómo se obtiene la nomenclatura de compuestos?
    11·1 answer
  • How many mol of oxygen in 2.5 mol of caffein??
    10·1 answer
  • Explain the structure of an atom. Make sure to include the charges of the subatomic particles.
    10·1 answer
  • When 18.0 g H20 is mixed with 33.5 g Fe, which is the limiting reactant?
    12·1 answer
  • Zn + 2MnO2 + 2H2O → Zn(OH)2 + 2MnO(OH) (balanced equation)
    11·1 answer
  • Which equation shows ejection of an alpha particle?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!