1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry_Shevchenko [17]
3 years ago
8

One of the main goals of environmental science is to help humans use the environment in a way that is economically profitable.

Chemistry
1 answer:
kkurt [141]3 years ago
5 0

Answer:

true this is correct its your econimically

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
For+the+reaction+H2+++I2+-+2HI+the+equilibrium+constant,+kc+is+49+at+a+fixed+temperature.+Two+mole+of+hydrogen+and+two+moles+of+
Sonja [21]

Answer : The initial concentration of HI and concentration of HI at equilibrium is, 0.27 M and 0.386 M  respectively.

Solution :  Given,

Initial concentration of H_2 and I_2 = 0.11 M

Concentration of H_2 and I_2 at equilibrium = 0.052 M

Let the initial concentration of HI be, C

The given equilibrium reaction is,

    H_2(g)+I_2(g)\rightleftharpoons 2HI(g)

Initially               0.11   0.11            C

At equilibrium  (0.11-x) (0.11-x)   (C+2x)

As we are given that:

Concentration of H_2 and I_2 at equilibrium = 0.052 M  = (0.11-x)

The expression of K_c will be,

K_c=\frac{[HI]^2}{[H_2][I_2]}

54.3=\frac{(C+2(0.058))^2}{(0.052)\times (0.052)}

By solving the terms, we get:

C = 0.27 M

Thus, initial concentration of HI = C = 0.27 M

Thus, the concentration of HI at equilibrium = (C+2x) = 0.27 + 2(0.058) = 0.386 M

3 0
3 years ago
How many grams of Cl2 are consumed to produce 12.0 g of KCl?
Alla [95]

The reaction is:

Cl2 + 2 KBr --> 2 KCl + Br2

Moles of KCl is

n = m /M = 12 /74 = 0.16 mol

As, twice the moles of KCl is producing from 1 mol of chlorine

mole of Cl2 = 0.16 /2 = 0.08 mol

Mass of Cl2

m /70 = 0.08 = 5.6 g

Hence, 5.6 g mol Cl2 consumed to produce KCl

7 0
3 years ago
What is anything that has mass and volume
Pavlova-9 [17]
Anything that has mass and volume (takes up space) is called matter.
3 0
3 years ago
Read 2 more answers
For the reaction 2NH3(g) + 2O2(g)N2O(g) + 3H2O(l) H° = -683.1 kJ and S° = -365.6 J/K The standard free energy change for the rea
BlackZzzverrR [31]

Answer:

\Delta G^{0} = -457.9 kJ and reaction is product favored.

Explanation:

The given reaction is associated with 2 moles of NH_{3}

Standard free energy change of the reaction (\Delta G^{0}) is given as:

           \Delta G^{0}=\Delta H^{0}-T\Delta S^{0}   , where T represents temperature in kelvin scale

So, \Delta G^{0}=(-683.1\times 10^{3})J-(273K\times -365.6J/K)=-583291.2J

So, for the reaction of 1.57 moles of NH_{3}, \Delta G^{0}=(\frac{1.57}{2})\times -583291.2J=-457883.592J=-457.9kJ

As, \Delta G^{0} is negative therefore reaction is product favored under standard condition.

6 0
3 years ago
Other questions:
  • What makes up 90 percent of interstellar gas? hints what makes up 90 percent of interstellar gas? hydrogen carbon dioxide helium
    11·1 answer
  • The hcl(g) molecule has a bond length of 127 pm and a dipole moment of 1.08
    11·1 answer
  • All molecules are compounds<br> True or false
    13·1 answer
  • Keri has to identify a mysterious brown liquid in science class. She pours it through a filter, but the substance looks the same
    5·2 answers
  • What is the identity of an alpha particle?
    15·2 answers
  • The Greeks were the first to use the term _____. atom electron neutron proton
    7·2 answers
  • How many protons are in the nucleus of an atom with an atomic number of 15?
    8·1 answer
  • A sample of lake water was analyzed to determine the amount of metals found in the lake. The standard deviation of the sampling
    11·1 answer
  • How many atoms in total are there in 7.35 mol of magnesium oxide (MgO)<br> molecules?
    7·1 answer
  • What is the mass of 0.78 mol Mg(NO3),? Make sure to round to the correct number of sig figs and to include the unit in your fina
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!