1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
V125BC [204]
3 years ago
5

answer the following: a. Explain how a pulley changes the amount of force needed to lift an object. b. do all pulleys change the

amount of force needed to move an object? Justify your answer.
Chemistry
1 answer:
Natalija [7]3 years ago
8 0
<span> If you want to lift something that weighs 100kg, you have to pull down with a force equivalent to 100kg, which is 1000N (newtons). I hope this helps, please mark brainiest if it does. I will attach a picture I found off the internet to further help you  :)
(There are like 1,000,000,000,000,000,000,000 other ways I could have put that, to make it sound less creepy, I could just edit it now instead of writing this huge thing... oh well lol)
</span>
You might be interested in
What is the atomic number of xenon, the fifith element in group 18?
Agata [3.3K]
The atomic number is also the number of protons in the nucleus of an atom of a specific element, in this case Xenon. Xenon is represented on the periodic table as Xe. Find that and look at the number in the top center of the square for Xenon. In this case, the atomic number is 54.
6 0
3 years ago
Which man made element is in an anomalous location
krok68 [10]
 the man made element that is in an anomalous location is Transuranium.
6 0
3 years ago
Read 2 more answers
Science fair ideas? please help
egoroff_w [7]
You can Maybe do a volcano?
8 0
3 years ago
Read 2 more answers
Which part of the food web is NOT a living thing?
stiks02 [169]

Answer:

the sun

Explanation:

the sun is not alive and plants use photosynthesis to eat the radiation emitted by the sun.

4 0
3 years ago
Can anyone help me part 1
valina [46]
I can help you with part 1
8 0
3 years ago
Other questions:
  • What is the one way the otter is adapted to living in the moving water of a river
    15·1 answer
  • An element has the following natural abundances and isotopic masses: 90.92% abundance with 19.99 amu, 0.26% abundance with 20.99
    11·1 answer
  • What is the difference between asexual and sexual
    12·2 answers
  • A 25.00-ml sample of propionic acid, hc3h5o2, of unknown concentration was titrated with 0.141 m koh. the equivalence point was
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • B) The student then does the titration correctly.
    8·1 answer
  • Volume and mass examples
    11·1 answer
  • Two plastic containers are washed in a dishwasher. One keeps its shape and the other becomes deformed.
    12·1 answer
  • 1- If an atom lose 2 electrons it will give………… A) Ion with 2+ charge called cation C) Ion with 3+ charge called cation B) Ion w
    9·2 answers
  • M + e- ---&gt; M-1 Is M an oxidizing or reducing agent?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!