1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
6

When an animal dies, what happens to the energy stored in the animal?

Biology
1 answer:
Rudik [331]3 years ago
7 0
It is released into the atmosphere and mixed in with carbon monoxide
You might be interested in
HELP PLS !!!!!!!!!!!!!!!!!!!!!!
gregori [183]
Haploid gametes egg/ sperm body cells
4 0
3 years ago
18. Which of the following describes a community?*
Sedbober [7]
The answer is C because the key is “group that live in the same area”
3 0
2 years ago
What is carrying capacity
valentina_108 [34]

Answer:

carrying capacity is how much population an environment can hold without its resources being used up/ when a Population Hits Its Limit. an example would be The Carrying Capacity of North American Deer. the Carrying Capacity of Grazing Cattle.

hope this helped!

8 0
3 years ago
Communication between neurons occurs from contact between the two neurons. when the intensity of the action potential increases
Kitty [74]

Answer:

The correct answer is - when action potentials trigger the release of neurotransmitters.

Explanation:

Communication between neurons takes place by signaling that can be either chemical signaling or electrical signals. Communication between neurons occurs at very small gaps known as synapses.

These synapses have two specialized cells that help two neurons communicate by one to another to allow for chemical transmission. The chemical that isreleased due to the stimulation of the action potential in order to communicate the neurons are known as neurotransmitters that allow for transmission.

8 0
3 years ago
A caterpillar eats only plants. a robin eats the caterpillar. what is the role of the robin in this system? A: Producer B:Decomp
dmitriy555 [2]
I think is D.... But I will double check
5 0
3 years ago
Read 2 more answers
Other questions:
  • Name the parts of the digestive system which acts like a speed bump to control the movement of food in our alimentary canal.
    15·1 answer
  • What type of mutation has occurred in the dna of people with sickle cell anemia? (look back, if you need to, to see what causes
    8·1 answer
  • Which is not true about investments: Never invest using borrowed money. Diversification will help lower the risk. Always invest
    11·1 answer
  • What are the two major components of a carbon footprint<br> and Why?
    15·1 answer
  • You are a community psychologist with a goal of increasing voter turnout in a community. Please identify and describe your commu
    9·1 answer
  • What is the primary function of a plant's root hairs?
    10·1 answer
  • What is an advantage of using cell culture rather than bacterial culture to produce biological molecules?
    15·1 answer
  • HELP! What are some of the reasons Humans depend on the ocean? - How do humans impact the ocean? - Since we humans depend on the
    10·1 answer
  • What is the best explanation for the faster times of the group fed a pre-race meal of bread with bananas and honey
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!