1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guapka [62]
3 years ago
9

Complete combustion of a 0.350 g sample of a compound in a bomb calorimeter releases 14.0 kJ of heat. The bomb calorimeter has a

mass of 1.20 kg and a specific heat of 3.55 J/(gi°C). If the initial temperature of the calorimeter is 22.5°C, what is its final temperature? Use q equals m C subscript p Delta T..
Chemistry
2 answers:
Sauron [17]3 years ago
5 0

Answer:

25.8 °C

Explanation:

The amount of heat released by the compound in a bomb calorimeter is 14.0kJ,

But heat released by the compound will be equal to the heat gained by the calorimeter. 

Heat energy = mass × specific heat × change in temperature.

Therefore;

14000 J = 1200 g × 3.55 ×(x-22.5)

14000 = 4260 (x-22.5)

x-22.5 = 3.286

       x = 25.786

          ≈ 25.9

Therefore, the final temperature is 25.8 °c

dexar [7]3 years ago
3 0

Answer:

Its final temperature is 25.8 °C

Explanation:

Calorimetry is the measurement and calculation of the amounts of heat exchanged by a body or a system.

There is a direct proportional relationship between heat and temperature. The constant of proportionality depends on the substance that constitutes the body as on its mass, and is the product of the specific heat by the mass of the body. So, the equation that allows calculating heat exchanges is:

Q = c * m * ΔT

where Q is the heat exchanged by a body of mass m, made up of a specific heat substance c and where ΔT is the temperature variation (ΔT=Tfinal-Tinitial)

When a body transmits heat there is another that receives it. This is the principle of the calorimeter. Then the heat released by the compound will be equal to the heat obtained by the calorimeter.

In this case, you know:

  • Q= 14 kJ= 14,000 J
  • c= 3.55  \frac{J}{g*C}
  • m=1.20 kg= 1200 g (1 kg=1000 g)
  • Tfinal= ?
  • Tinitial= 22.5 °C

Replacing:

14,000 J= 3.55 \frac{J}{g*C}*1200 g*(Tfinal-22.5C)

Solving:

\frac{14,000J}{3.55\frac{J}{g*C} *1200 g} =T final - 22.5C

3.3=Tfinal - 22.5 C

3.3 + 22.5=Tfinal

Tfinal= 25.8 °C

<u><em>Its final temperature is 25.8 °C</em></u>

You might be interested in
Write word and balanced chemical equations to show the
Alex777 [14]

Answer:

chemical laboratory Pune Maharashtra India

5 0
3 years ago
Which of the following correctly describes the law of conservation of energy
egoroff_w [7]
Mass and energy can not be created or destroyed, they may be able to just be converted, and neither one seems without the opposite. For this reason in closed systems, both mass and energy are conserved individually. " I hope this helps "
3 0
3 years ago
(20 Points!!!!!)
trasher [3.6K]

i am pretty sure it would be a chemical change so A

3 0
3 years ago
Read 2 more answers
If 26.2 grams of a pure compound contain 8.77 × 1022 molecules, what is the molecular weight of this compound? Answer in units o
Nataly [62]

Answer:

Mw = 179.845 g/mol

Explanation:

  • Mw [=] g/mol

∴ w = 26.2 g

∴ 1 mol = 6.02 E23 molecules.......Avogadro's number

⇒N° moles = 8.77 E22 molecules * ( mol / 6.02 E23 molecules ) = 0.146 mol

⇒ Mw = 26.2 g / 0.146 mol = 179.845 g/mol

3 0
3 years ago
Not too sure about this one
Kazeer [188]

Answer:

It should be polarity

8 0
3 years ago
Other questions:
  • If in the following diagram the substance is in the solid state during stage 1, what is happening during stage 2?
    5·2 answers
  • X2SO3 Enter the group number of X. How do I find this? Chemistry
    12·2 answers
  • A solid white substance A is heated strongly in the absence of air. It decomposes to form a new white crystalline substance B an
    13·1 answer
  • 18. An example of an atom that has no
    12·2 answers
  • Can some body please help me with this Stoichiometry stuff
    11·1 answer
  • The label on a bottle reads 10 mg of furosemide per mL. How many mg of furosemide do you have in a 250 mL bottle?
    14·1 answer
  • What is the initial temperature (in Celsius) of a 675 ml balloon if the
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Four students drew part of the rock cycle on the board. Which drawing was correct?
    9·1 answer
  • What is the connection of ascorbic acid when one tablet is dissolved in 200cm cubed of water ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!