1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
12

Distilled water has a hydronium ion concentration of 1 × 10–7 M. What is the pH of distilled water?

Chemistry
1 answer:
Sati [7]3 years ago
5 0
The pH balance is 7

hope this helps
You might be interested in
Which term refers to a small group of atoms that are attached to larger molecules, providing them with specific chemical propert
stepan [7]
Answer: Small groups of atoms that are attached to larger molecules, giving the specific chemical properties, are called functional groups.

explanation: Functional groups are groups of atoms in a molecule that possess the same chemical feature every time it appears in several compounds. There are various types of functional groups and they have the tendency to react in definite ways. Examples include; the ether functional group (consists of an oxygen atom that forms single bonds with two carbon atoms),the alcohol functional group (consists of an oxygen atom that is bonded to one hydrogen atom and one carbon atom), and the amine functional group (consists of a nitrogen atom bonded to some combination of carbons and hydrogens).
5 0
2 years ago
For her school Science Fair, Alyssa designs an experiment to learn more about erosion. Her experimental set up is shown below. W
shutvik [7]

Answer:                                                                                                                                

if I am going to answer I need the set up

Explanation:

please show the set up and I will answer the question

8 0
3 years ago
In Universe , recently discovered by an intrepid team of chemists who also happen to have studied interdimensional travel, quant
tiny-mole [99]

Answer:

Check the explanation

Explanation:

When talking about our universe there are 5 d orbitals. The element of first transition series moves away from the universal principles of Hund's rule and Aufbav's principle. So in order to attain stability these elements tend to form half or full filled orbitals.

In our universe the ground state electronic configuration of sixth transition metal, Iron (Fe) :  [Ar] 3d^{6} 4s^{2}

and the electronic configuration of seventh transition metal, Cobalt (Co) :  [Ar] 3d^{7} 4s^{2}

=================================

=================================

In universe L there are seven orbitals.

Ground state electronic configuration of sixth and seven transition element.

Sixth transition metal: [Ar] 3d^{7} 4s^1 or [X] 3d^{7} 4s^1

Seventh transition metal: [Ar] 3d^{7} 4s^{2}or [X] 3d^{7} 4s^{2}

7 0
3 years ago
For each of the following statements, determine if the trend will increase or decrease. As you move from left to right across th
iren [92.7K]

Answer:

I just did the assignment it's "decreases"

Explanation:

If you guys came from Ed-genuity (i'm writing it like that because apperantly that is a swear word?) That means the next questions are "As you move from left to right across the periodic table, electronegativity..." and "As you move from top to bottom within a group, the first ionization energy...".

for electronegativity, it's increases and for ionization energy it's decreases. Hope this helps!

3 0
3 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • How many particles are present in this diagram?
    13·2 answers
  • Please help me i keep getting this wrong :(
    11·1 answer
  • 9. What lab equipment is used to spread heat when heating to prevent glassware from cracking
    12·1 answer
  • 30 POINTS IF YOU CAN FIND THE ANSWER. When is Earth's axis tilted neither toward nor away from the sun?
    7·1 answer
  • How much energy is transferred when 30.0<br> g of water is cooled from 25.0 °C to 12.7 °C.
    10·1 answer
  • One isotope of oxygen has 8 protons and 10 neutrons. Which is the correct reference for this isotope? A. oxygen-18 B. oxygen-2 C
    7·1 answer
  • A device that does work with only one movement is a simple machine <br> true or false
    14·1 answer
  • Which group has the greatest metallic character?
    9·1 answer
  • An atom has the following electron configuration.
    10·1 answer
  • Two bidentate ligands used extensively in analytical chemistry are bipyridyl (bipy) and ortho-phenanthroline (o-phen):Draw struc
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!