1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vredina [299]
3 years ago
10

What structure do insects have for breathing (A) gills (B) tracheae (C) skin (D) lungs

Chemistry
1 answer:
den301095 [7]3 years ago
7 0
I believe tracheae!!!!
You might be interested in
Which of the following is a chemical property? freezing point color ability to react with oxygen hardness
Alenkasestr [34]
<span>Oxidation or reaction with oxygen is a chemical property</span>
4 0
3 years ago
Read 2 more answers
SCIENCE!!!! PLEASE HELP!!! 20 POINTS
Annette [7]

Answer:

As the Earth rotates, it also moves, or revolves, around the Sun. ... As the Earth orbits the Sun, the Moon orbits the Earth. The Moon's orbit lasts 27 1/2 days, but because the Earth keeps moving, it takes the Moon two extra days, 29 1/2, to come back to the same place in our sky.

Explanation:

4 0
2 years ago
Read 2 more answers
Determine the velocity of a 55-kg skier whose kinetic energy is 8900 J
goldfiish [28.3K]

Answer:

Kinetic energy = 1/2mv^2

8900 j =1/2*55*v^2

v^2=8900*2/55

v^2=323.6

v=17.98

Explanation:

4 0
2 years ago
Consider the unbalanced equation for the oxidation of aluminum.
SashulF [63]
In order to balance an equation, we apply the principle of conservation of mass, which states that mass can neither be created nor destroyed. Therefore, the mass of an element before and after a reaction remains constant. Here, the balanced equation becomes:
4Al + 3O₂ → 2Al₂O₃

The coefficients are 4, 3 and 2.
8 0
2 years ago
Read 2 more answers
Which one of the following is not a valid expression for the rate of the reaction below? 4NH3 + 7O2 → 4NO2 + 6H2O Which one of t
Veseljchak [2.6K]

Answer : All of the above are valid expressions of the reaction rate.

Explanation :

The given rate of reaction is,

4NH_3+7O_2\rightarrow 4NO_2+6H_2O

The expression for rate of reaction for the reactant :

\text{Rate of disappearance of }NH_3=-\frac{1}{4}\times \frac{d[NH_3]}{dt}

\text{Rate of disappearance of }O_2=-\frac{1}{7}\times \frac{d[O_2]}{dt}

The expression for rate of reaction for the product :

\text{Rate of formation of }NO_2=+\frac{1}{4}\times \frac{d[NO_2]}{dt}

\text{Rate of formation of }H_2O=+\frac{1}{6}\times \frac{d[H_2O]}{dt}

From this we conclude that, all the options are correct.

3 0
2 years ago
Other questions:
  • Rank these systems in order of decreasing entropy. 1 = Greatest entropy and 7 = Least entropy. Group of answer choices 1 mol of
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Butter has a specific gravity of 0.86. What is the mass of 2.15 L of butter?
    12·1 answer
  • Kw, the equilibrium constant for the ionization of water by the equation below, is 1.0 x 10-14. what does that mean when we are
    15·1 answer
  • The gas in a 600. mL balloon has a pressure of 1.20 atm. If the temperature remains constant, what will be the pressure of the g
    13·1 answer
  • Solid ice will change to liquid water and then to gaseous steam when you add
    12·1 answer
  • Which of the following elements is a representative element?
    10·1 answer
  • It takes three seismograph stations to determine the epicenter of an earthquake. Each station can determine how far away the ear
    10·1 answer
  • What is meant by Redox reaction ? ​
    15·1 answer
  • Compare and contrast the carbon cycle of 1500 and of 2021
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!