1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
3 years ago
5

If, and only blood sugar levels rise past a certain point, the cells will release a hormone called insulin. Insulin acts as a/an

in a homeostatic feedback loop
Biology
1 answer:
lakkis [162]3 years ago
6 0

Answer:

When blood glucose level rises beyond the threshold levels, the pancreas secrets hormones insulin. The latter ensures entry of  glucose into the cells through Glut transporters for cellular utilization, therefore reducing the blood levels., and promotes storage as glycogen in the liver and muscles.  

How ever if  the glucose levels drops below the  set point, an hormone glucagon is also produce by the pancreas to cause the liver o withdrawal and breakdown glucose storage as  glycogen back to glucose thus raising the blood glucose level back to the normal levels.

This is an example of negative feedback mechanism, because the increase in the input levels (blood glucose levels) brings about a counter  mechanisms (insulin secretions)as output , to reduce the  elevated   levels by promoting  entry into the cells,, thus bringing the levels to threshold levels.

Thus insulin is acting in a negative feedback mechanism to control blood glucose levels

Explanation:

You might be interested in
Can a codon contain two of the same nucleotide bases?
omeli [17]

Answer:

Answer is Below

Explanation:

According to resourcegate.net, A codon consisting of a single base could only code for 4 amino acids, a length of two bases for 16 (4x4), and of three bases for 64 (4x4x4). Given that tRNAs have to interact via their anticodons with the mRNA, we have an upper limit for the codon length.

Hopes this helps :D

Mark me branliest Please

3 0
2 years ago
Read 2 more answers
What are the two circuits of the cardiovascular system? What does it mean to say that the cardiovascular system is a closed syst
maksim [4K]

Answer:

The two circuits of the cardiovascular system are: Pulmonary Circuit and Systematic Circuit. The pulmonary circuit is shorter than the systemic and is responsible for carrying deoxygenated blood to the lungs from the right atrium, for oxygenation. The systemic circuit is longer and leaves the aortic artery, carrying oxygenated blood throughout the body and nutrients for survival. If less blood were pumped into the systemic circuit, this amount would not be sufficient to compensate for the organism's needs, with the corresponding consequences that this would entail.  

It is said that the cardiovascular system is a closed system because blood travels inside a network of blood vessels without leaving them.

5 0
3 years ago
Which causes a drop in female hormone levels?
Anna [14]
A. The onset of the menstrual flow
5 0
3 years ago
Read 2 more answers
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
A harmful mutation can be caused by factors in the environment. True or False?
Scorpion4ik [409]
False is right.....................
3 0
3 years ago
Other questions:
  • Proteins are used for many structural functions such as in the actin and myosin in muscle or as a part of the cytoskeleton scaff
    6·1 answer
  • What are all living things for biomes
    7·1 answer
  • What are some fun facts on animal and plant cells.
    10·1 answer
  • If the air pack together tightly
    6·1 answer
  • Which of the following is NOT an aquatic biome?
    11·2 answers
  • Which plate borders the Philippine plate?
    8·2 answers
  • In his theory of natural selection, Darwin incorporated the premise that available resources were not sufficient for all members
    9·1 answer
  • Machine or application at home that transform energy from one form to another
    9·1 answer
  • 1. The location of two hikers is marked on the topographic map to the right as points F and H. What is the elevation of the camp
    15·1 answer
  • Which is the best description
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!