Answer:
Answer is Below
Explanation:
According to resourcegate.net, A codon consisting of a single base could only code for 4 amino acids, a length of two bases for 16 (4x4), and of three bases for 64 (4x4x4). Given that tRNAs have to interact via their anticodons with the mRNA, we have an upper limit for the codon length.
Hopes this helps :D
Mark me branliest Please
Answer:
The two circuits of the cardiovascular system are: Pulmonary Circuit and Systematic Circuit. The pulmonary circuit is shorter than the systemic and is responsible for carrying deoxygenated blood to the lungs from the right atrium, for oxygenation. The systemic circuit is longer and leaves the aortic artery, carrying oxygenated blood throughout the body and nutrients for survival. If less blood were pumped into the systemic circuit, this amount would not be sufficient to compensate for the organism's needs, with the corresponding consequences that this would entail.
It is said that the cardiovascular system is a closed system because blood travels inside a network of blood vessels without leaving them.
A. The onset of the menstrual flow
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
False is right.....................