Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The ph after 17.0 ml of 0.15 m Koh has been added to 15 ml of 0.20 m hclo4 is <u>3.347</u>.
Titration is a commonplace laboratory technique of quantitative chemical analysis to determine the attention of an identified analyte. A reagent, termed the titrant or titrator, is ready as a trendy answer of recognized awareness and extent.
<u>Calculation:-</u>
Normality of acid Normality of base
= nMV nMV
= 1 × 0. 15 × 0.017 1 × 0. 20 ×0.015 L
= 2.55 × 10⁻³ = 3 × 10⁻³
The overall base will be high
net concentration = 3× 10⁻³ - 2.55 × 10⁻³
= 0.45 × 10⁻³
= 4.5× 10⁻⁴
pH = -log[4.5 × 10⁻⁴]
= 4 - log4.4
= <u>3.347</u>
A titration is defined as 'the manner of determining the amount of a substance A by using adding measured increments of substance B, the titrant, with which it reacts till precise chemical equivalence is completed the equivalence factor.
Learn more about titration here:-brainly.com/question/186765
#SPJ4
Answer:
Mitochondria brings food and water to your cells
7 moles of oxygen are in the sample.
According to the chemical formula, each mole of nickel tetracarbonyl contains 4 moles of C atoms. Simply convert it into a fraction by putting the original solution in the denominator and the diluted solution in the numerator if you need to determine the concentration ratio between two solutions. The V/n ratio for each gas must be the same if the two gases are at the same temperature and pressure. The volume ratio of two gases at the same temperature and pressure is equal to their molar ratio. The mole ratio of C to O is 1 : 1
Learn more about moles here brainly.com/question/10873665
#SPJ1.
Answer:
<h3>D. c = fλ</h3>
Explanation:
c = fλ
where" c "is the speed of light ,
• "f" is the frequency of the electromagnetic waves,
• " λ" is its wavelength.
