1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
4 years ago
13

Consider a solution prepared by mixing the following:50.0 mL of 0.100 M Na3PO4100.0 mL of 0.0500 M KOH200.0 mL of 0.0750 M HCl50

.0 mL of 0.150 M NaCNDetermine the volume of 0.100 M HNO3 that must be added to this mixture to achieve a nal pH value of 7.21.
Chemistry
1 answer:
Juliette [100K]4 years ago
5 0

Answer:

you must add 50 mL

Explanation:

Hi

KOH is a strong base and by adding 100mL 0.05M you will have an amount of 5 millimol.

NaCN is a base and by adding 50 mL 0,150 M you will have an amount of 7,5 mmol.

HCl is a acid and by adding 200 mL 0,075 M you will have an amount of 15 mmol.

The acid reacts with the bases leaving 2.5 mmol unreacted.

Na3PO4 is a base and by adding 50 mL 0,1 M you will have an amount of 5 mmol.

The 2.5 mmol of acid react with the base PO4 ^ -3 forming a regulatory solution of PO4 ^ -3 and HPO4 ^ -2 of pKa 2.12

5 mmol of acid (HNO3) must be added to obtain a regulatory solution formed by the same amount of HPO4 ^ -2 (2.5 mmol) and H2PO4 ^ -1 (2.5 mmol) with pKa 7.21

Considering a quantity of 5 mmol of HNO3 of concentration 0.1 M, 50 mL must be added.

To calculate the pH of the regulatory solution you should consider pH = pKa × Ca / Cb pH = 7.21 × 2.5 / 2.5 = 7.21 Being in the same solution the volume is the same and can be simplified to achieve a faster calculation.

successes with your homework

You might be interested in
If a gas occupies a volume of 950 mL at standard temperature, what volume will it
n200080 [17]
Voulme 1= 950 mL
Volume 2= ?
Temperature 1 = 25 C
Temperature 2 = 50 C
Convert your temperature to Kelvin
C+273=K
Temperature 1 = 25 C + 273 = 298 K
Temperature 2 = 50 C + 273 = 323 K

Plug in to the Formula
950 mL/298 K = ? / 323 K

Rearrange the formula to make one to solve for what is missing.
To get 323 K out of the denominator multiply by it.
Making it
950 mL x 323 K / 298 K = ?

Plug it in
950 mL x 323 K / 298 K = 1027.9 mL
3 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
A substance containing atoms of different elements that are bonded together is called a(n):
ser-zykov [4K]

Answer:Molecules

Explanation:

3 0
4 years ago
Balance the following reaction. A coefficient of "1" is understood. Choose option "blank" for the correct answer if the
Vera_Pavlovna [14]

2NH₂ + O₂ → N₂ + 2H₂O

<u>Explanation:</u>

Balancing the equation means, the number of atoms on both sides of the equation must be the same.

In the case of the given equation, we have to find out whether it is balanced or not.

2NH₂ + O₂ →  N₂ + 2H₂O

Atoms       Number of atoms before balancing     after balancing

                 LHS                 RHS                                    LHS         RHS

N               1                        2                                            2              2

H               2                       2                                            4              4                        

O               2                       1                                            2                2

To balance the N atoms, we have to put 2 in front of NH₂, and then to balance the H, O atoms, we have to put 2 in front of H₂O, so that each atom in left hand as well as right hand side of the equation was balanced.

8 0
4 years ago
Colligative properties are dependent only on the number of particles in a solution, and not their identity. (select all that app
Cerrena [4.2K]
The answer will be apart of a 60 caculace so it will equal to a efficacy amount so d
7 0
3 years ago
Other questions:
  • As the mass of a sample increases, the number of moles present in the sample (increases)
    6·2 answers
  • Cual de los estados de agregacion es mas abundante en el universo
    5·1 answer
  • The vapor pressure of pure water at 250C is 23.77 torr. What is the vapor pressure of water above a solution that is 1.500 m glu
    6·1 answer
  • I need number 5,6 please thanks
    6·1 answer
  • Which discovery did J. J. Thomson make that improved upon Dalton's atomic theory?
    14·1 answer
  • 58.0 g of K2SO4 was dissolved in 500 g of water. What is the molality of this solution?
    10·1 answer
  • What is the element Ar classified as in the periodic table?
    8·2 answers
  • Heeeeeellllppp, Iiiimmm sssooo stttuuuccckkk!​
    12·1 answer
  • What happens when a wire passes through a magnetic field?
    5·2 answers
  • Define sonority.<br>Thank you!​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!