1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
13

+ 2 S_{2} O_{3}   ^{-2} ----> 2  I^{-} +S_{4} O_{6}^{-2}
(Find the Oxidant and reductant)
Chemistry
1 answer:
gogolik [260]3 years ago
7 0

Answer: I2 is the Oxidant; while the 2S2O3(-2) is the reductant.

Explanation:

An Oxidant is any substance that oxidizes, or receives electrons from, another; in so doing, it becomes reduced in oxidation number.

A Reductant thus exactly the opposite.

Note that the equation provided shows that Iodine (I2) received an electron to become NEGATIVELY CHARGED:

I2 --> 2I-.

The oxidation number reduced from 0 to -1.

In contrast, the oxidation number of 2S2O3(-2) increases from -4 to -2.

Thus, I2 is the Oxidant; while the 2S2O3(-2) is the reductant.

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
2 years ago
Kijoknm<br>gg hv jnb vcxvbnbvcvbnmnbvmnb
Vaselesa [24]
Kijoknm
gg hv jnb vcxbnbvcvbnmnbvmnb
4 0
2 years ago
What is the chemical reaction of aluminum and ferric oxide to produce iron and aluminum oxide?
AnnZ [28]

Answer:

Ferric oxide reacts with aluminium to produce aluminium oxide and iron. The balanced chemical equation for the given reaction is : Fe2O3 + 2Al → Al2O3 + 2Fe.

6 0
2 years ago
Which element(s) are not balanced in this equation ?
Alekssandra [29.7K]
Only the Fe is unbalanced.
:)
3 0
3 years ago
Read 2 more answers
I need a Help plz! It’s my final exam!
LekaFEV [45]
Um i think gold... i think?
7 0
2 years ago
Other questions:
  • All of the following statements about solutions are correct Except?
    5·1 answer
  • Ammonia reacts with diatomic oxygen to form nitric oxide and water vapor: 4nh3 + 5o2 → 4no + 6h2o when 40.0 g nh3 and 50.0 g o2
    12·1 answer
  • Are all synthetic products bad?
    5·1 answer
  • Look this is a weird question to ask but am asking it anyways
    11·2 answers
  • What mass of Al would be obtained from the complete reduction of 10.2 tonnes of Al2O3?
    13·1 answer
  • What type of experiment is based on a comparison between a control group and an experimental group ?
    13·1 answer
  • List the different kinds of nitrogen bases
    7·1 answer
  • Phosphorus reacts with oxygen to produce different kinds
    11·1 answer
  • Plants absorb ______ from the atmosphere and release _______ to the atmosphere.
    7·1 answer
  • Describe the arrangement and movement of the octane molecules when it is a liquid​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!