1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ludmilkaskok [199]
4 years ago
14

Convert 840 mL to liters ( be sure to keep the appropriate number of significant figures - also, only enter a number DO NOT INCL

UDE UNITS)
Chemistry
1 answer:
Sholpan [36]4 years ago
8 0
0.84. I think ... sorry if this is wrong!
You might be interested in
Why the mixture of bromine and ethane is discoloured when left in the sun​
DENIUS [597]

Answer:

In the presence of UV light, ethane will react with bromine in a substitution reaction. UV light is the condition under which the reaction will occur so it is written above the arrow in the chemical equation. As the reaction proceeds, the intensity of the re-brown colour of the bromine water decreases.

8 0
2 years ago
Read 2 more answers
A home is heated by a system that uses sunlight to warm water in pipes. Which statement best describes this system?
juin [17]

Answer:

In which part of a nuclear power plant does fission take place? A home is heated by a system that uses sunlight to warm water in pipes. Which statement best describes this system? An active solar system because sunlight shines on the pipes naturally.

Explanation:

Hope it helps

FOLLOW MY ACCOUNT PLS PLS

5 0
3 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
List three branches life<br>Science and describe what studied in each?​
Mama L [17]

Answer:

First off Life sciences are anything concerned with the study of a living organisms. So ones that would be included would be, microbiology biology, botany, zoology, ecology, genetics and medicine, from what the dictionary states

Explanation:

Biology is the natural science that studies life and living organisms. Which also includes molecular interactions, including their physical structure.

Genetics, is the study of heredity and or the variation of inherited characteristics that we get from family.

Microbiology, is the branch of science which deals with microorganisms.

Let me know if this helps, if not I'll continue researching.

3 0
3 years ago
If a 28.0 L balloon with a temperature of
Alexeev081 [22]

Answer:

5.6 L

Explanation:

We can apply Charles' Law here since our pressure is constant (will not change inside the refrigerator) and we are relating change in volume with change in temperature:

V₁ / T₁ = V₂ / T₂ where V₁ and T₁ are initial volume and temperature, and V₂ and T₂ are final volume and temperature. Let's plug in what we know and solve for the unknown:

28.0 L / 25 °C = V₂ / 5 °C => V₂ = 5.6 L

5.6 L is our new volume (at 5 °C).

6 0
3 years ago
Other questions:
  • which type of particle is not present in the same amount as the other types of particles in a neutral atom
    7·1 answer
  • Which element on the periodic table is found in liver and is needed to prevent anaemia
    15·1 answer
  • Which terms are used to identify pure substances
    8·2 answers
  • Plz help me.. plzzzzzzzz
    8·1 answer
  • How would the graph change if a catalyst were used
    11·1 answer
  • Two aqueous NaCl solutions of equal volume and concentration were kept in flasks and held at different temperatures. The two sol
    10·1 answer
  • Balance the following equation <br> _MgF2 + _Li2CO3 -&gt; _MgCO3 + _LiF
    7·1 answer
  • Water pollution has severely impacted animals and plants in New York's Hudson
    8·1 answer
  • Someone pls help me ::/:/
    12·1 answer
  • Why are environmental factors important to consider when assessing an individual’s health? a. environmental factors are the sole
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!