1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
13

I am helpful fo long term energy storage. what am i?

Biology
1 answer:
VLD [36.1K]3 years ago
5 0

i think that it is a generator
You might be interested in
Why are fences put along some beaches ?
kvv77 [185]

The answer is; B

Sometimes winds carry the sand of the beaches causing erosion. The fences act as breakers of this wind erosion. As wind tries to carry the sand, they encounter the fence and 'break'. Therefore, the sand is deposited along the fence forming a sand dune. These dunes also form protection from storm surges.

6 0
4 years ago
How many atoms are present in a molecule of aluminum sulphide
denpristay [2]

Answer:

3 atoms of S and 2 atoms of Al

3 0
3 years ago
Read 2 more answers
The synthesis of giant molecules from components of repeating units is _____. polymerization hydrolysis
Bezzdna [24]
Polymerization would be the answer you're looking for.
5 0
3 years ago
Read 2 more answers
Tell properties cell membrane​
densk [106]

Answer:

properties cell membranes

4 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • The residual volume is approximately ________l in an adult human.
    9·1 answer
  • What is a substrate?
    11·1 answer
  • What is the type of motion that exists for objects traveling in only one direction.
    9·2 answers
  • Tundra is known for its _______.??????
    14·1 answer
  • Restriction of fat has been a popular strategy for weight loss and health, but fat performs some important functions, in additio
    12·1 answer
  • The Human Body is made up over
    11·2 answers
  • A student claims that the monarch population increases and decreases in a cycle, similar to the pattern of predator-prey populat
    11·1 answer
  • 2. Place these steps in the correct order to explain
    7·1 answer
  • How do organisms within the population share and compete for things they need to survive?
    10·1 answer
  • When do electrons form an electrical current?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!