1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
11

Help me. ASAP!!!!! 23 POINTS!!!!!!!

Chemistry
1 answer:
Alona [7]3 years ago
6 0
a) Group 2 elements have 2 electrons on their outer shell, so they form a 2+ charge.

b) they lose 2 electrons as they are transferred to the non metal.

c)They obtain this charge as when they are made into an ionic compound the 2 electrons on the outer shell are transferred to the non metal, meaning there are 2 more protons that electrons, giving it a positive charge.

hope this helps! :)
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
6. What causes the phases of the moon?
lawyer [7]

Answer:

The rotation of the Earth.

6 0
2 years ago
Ultraviolet radiation and radiation of shorter wavelengths can damage biological molecules because they carry enough energy to b
Alja [10]

Answer:

439.7nm

Explanation:

Energy of a quantum can be calculated using below formula

E=hv...........eqn(1)

But v=λ/ c .........eqn(2)

If we substitute eqn(2) into eqn(1) we have

E= hc/(λ)

Where E= energy

h= Plank's constant= 6.62607004 × 10-34 m2 kg / s

c= speed of light

c= 2.998 × 10^8 m/s

λ= wavelength= ?

But the energy was given in Kj , it must be converted to Kj/ photon for unit consistency.

Energy E= 272 kJ/mol × 1mol/6.02× 10^23

Energy= 451.83× 10^-24 Kj/ photon

E= hc/(λ)...........eqn(1)

If we make λ subject of the formula

λ= hc/E

Then substitute the values we have

λ= [(6.626 × 10^-34) × (2.998 × 10^8)]/451.83× 10^-24

λ=(0.00043965) × (1Kj/1000J) × (10^9nm/1m)

λ=439.7nm

Hence, the longest wavelength of radiation with enough energy to break carbon-sulfur bonds is 439.7nm

4 0
2 years ago
In a 1.0× 10–6 M solution of Ba(OH)2(aq) at 25 °C, identify the relative molar amounts of these species.
Marysya12 [62]
Thank you for posting your question here. Below is the solution:

HNO3 --> H+ + NO3- 
<span>HNO3 = strong acid so 100% dissociation </span>
<span>** one doesn't need to find the molarity of water since it is the solvent </span>

<span>0M HNO3 </span>
<span>1x10^-6M H3O+ </span>
<span>1x10^-6M NO3- </span>
<span>1x10^-8M OH-.....the Kw = 1x10^-14 = [H+][OH-] </span>
<span>you have 1x10^-6M H+ so, 1x10^-14 / 1x10^-6 = 1x10^-8M OH- </span>


<span>1x10^-6 Ba(OH)2 = strong base, 100% dissociation </span>
<span>1x10^-6M Ba2+ </span>
<span>2x10^-6M OH- since there are 2 OH- / 1 Ba2+ </span>
<span>0M Ba(OH)2 </span>
<span>5x10^-9M H3O+</span>
4 0
3 years ago
What family has 4 valence electrons?
PilotLPTM [1.2K]

Answer:carbon group

Explanation:

4 0
3 years ago
Other questions:
  • Silver is a precious metal. The price of silver fluctuates daily as it is traded on the open market. Look up the current market
    15·1 answer
  • What volume of a 6.0m hcl solution is required to make 250.0 milliters of 1.5 m hcl
    13·1 answer
  • A physical structure or a behavior that helps an organism to survive in its environment is
    14·1 answer
  • Help!: Determine the mass of oxygen that can be removed from 25.0 grams of Fe2O3?
    6·1 answer
  • The energy produced when nucleons fuse together is called the: Select the correct answer below:
    12·1 answer
  • What is the purpose of strawberry seeds
    6·1 answer
  • Based on the fossil records, what is true
    14·1 answer
  • PLZ SOMEONE HELP I’LL MARK AS BRAINLIEST!!!
    8·1 answer
  • A solution with a volume of 4.0 L that contains 2.0 mol of KNOg has a molarity of
    14·1 answer
  • Damian places a negatively charged balloon in a magnetic field. Which direction will the balloon move?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!