Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
<h2>For the action question: Increases in energy efficiency</h2><h2></h2><h2>For the question in the picture: converging tectonic plates</h2>
Answer:
It reduces the diameter of an artery
Explanation:
<em>Atherosclerosis results in the deposition of plaques on the arterial wall. The plaque deposition narrows the diameter of the artery and consequently interferes with the flow of blood through the artery in the process. </em>
Hence, atherosclerosis functions by reducing the diameter of an artery due to plaque deposition.
Answer:
B. Before sperm and egg cells form.
Explanation:
An organism become a juvenile during its life cycle before sperm and egg cells form. juvenile is a stage in which organism is immature and young. The y just enter into the young stage. Every animal has three basic stages in their life cycles that starts as a fertilized egg, developing into an immature juvenile, and then transforming into an adult. The first stage occurs when the fusion of sperm and egg cells occur whereas adult is the mature stage of that organism.
The role of respiration is to take in oxygen and push out carbon dioxide. The respiration takes place in the mitochondrian which is found in the cytoplasm.
Hope this Helps!
