1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sukhopar [10]
3 years ago
5

The Moon takes one year to complete its phases. True or False

Biology
2 answers:
Anon25 [30]3 years ago
8 0

Answer:

False

Explanation:

the moon takes about a month to go through all of its stages.

grin007 [14]3 years ago
7 0

Answer:

False

Explanation:

The moon only takes about 30 days to complete its phases.

You might be interested in
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
Please help bffbgfg5vrvtvt 2 things
nikdorinn [45]
<h2>For the action question: Increases in energy efficiency</h2><h2></h2><h2>For the question in the picture: converging tectonic plates</h2>
5 0
3 years ago
Read 2 more answers
Many individuals suffer from atherosclerosis, an arterial disease that effects large to medium-sized muscular arteries. What doe
Leviafan [203]

Answer:

It reduces the diameter of an artery

Explanation:

<em>Atherosclerosis results in the deposition of plaques on the arterial wall. The plaque deposition narrows the diameter of the artery and consequently interferes with the flow of blood through the artery in the process. </em>

Hence, atherosclerosis functions by reducing the diameter of an artery due to plaque deposition.

4 0
3 years ago
Read 2 more answers
Question 3 of 5
xz_007 [3.2K]

Answer:

B. Before sperm and egg cells form.

Explanation:

An organism become a juvenile during its life cycle before sperm and egg cells form. juvenile is a stage in which organism is immature and young. The y just enter into the young stage. Every animal has three basic stages in their life cycles that starts as a fertilized egg, developing into an immature juvenile, and then transforming into an adult. The first stage occurs when the fusion of sperm and egg cells occur whereas adult is the mature stage of that organism.

8 0
3 years ago
What is the role of respiration and where does this take place
Flauer [41]
The role of respiration is to take in oxygen and push out carbon dioxide. The respiration takes place in the mitochondrian which is found in the cytoplasm.

Hope this Helps!
3 0
4 years ago
Other questions:
  • How does ATP supply energy for cellular activities?
    14·2 answers
  • Unattached earlobes are dominant to attached earlobes. Cleft chin is dominant to no cleft. Parents that are heterozygous for bot
    8·1 answer
  • Which of the following is NOT an example of physical weathering?
    14·2 answers
  • Which of the following is characteristic of complex multicellularity?
    8·1 answer
  • What causes an unsaturated fatty acid to have a different shape than a
    7·1 answer
  • Why must all living things carry on respiration
    10·2 answers
  • Negative feedback is not commonly used to correct homeostatic imbalances. True or false
    12·1 answer
  • Different types of protists move in different ways. Describe how one type of protists you observed moves. Be specific.
    7·1 answer
  • Which of the below is NOT an example of an ecosystem service?
    12·1 answer
  • WILL GIVE BRANIEST AND POINTS!!!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!