1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
3 years ago
8

Why are plants found at the beginning of a food web

Biology
2 answers:
Debora [2.8K]3 years ago
6 0

Hello Hope this helps  plants use solar energy in a chemical process to produce food.

prohojiy [21]3 years ago
4 0

because plants give energy to the primary consumers, or whatever shiii idk,  and plants don't eat anything so they my as well be first , cause they're just that cool


You might be interested in
For each molecule of glucose consumed, how many times does the Krebs cycle occur?
bagirrra123 [75]
For each molecule of glucose consumed, the Krebs cycle occurs: D. twice
1 glucose --> 2 pyruvate, each one entering the Krebs as acetyl-CoA
3 0
3 years ago
Read 2 more answers
If Gloria gets violently ill a couple of hours after eating contaminated food, she will probably develop an aversion to the tast
Lena [83]

Answer:

Biological predispositions

Explanation:

A Biological Predisposition is an expanded possibility of building up an infection or example of conduct dependent on the qualities we acquired from our folks (and our's folks). Qualities impact our character attributes, our IQ, our probability of getting malignant growth, and even our odds of turning into a heavy drinker.

Being predisposed to a turmoil doesn't imply that we will create it, just that we are progressively powerless against it dependent on our hereditary cosmetics. Natural hazard variables join with ecological factors, for example, stress or diet to trigger a confusion.

Research studies utilizing twins have demonstrated that numerous attributes and disarranges are heritable. For instance, in indistinguishable twin sets, on the off chance that one twin is determined to have schizophrenia, there is a half shot that the other twin will likewise be analyzed. Be that as it may, in congenial twin matches, this rate is just 15%. Since indistinguishable twins share a larger number of qualities than brotherly twins, we can infer that schizophrenia has an acquired organic premise.

8 0
3 years ago
What are meristematic tissues?
svetlana [45]
Meristematic tissue is the dividing tissue present at the growing regions of the plants. They are meant for growth of an organ Cells of meristems divide continuously and help in increasing the length and girth of the plant
The cells of this tissue are similar in structure and have thin cellulose cell walls
The cells do not contain any intercellular space between them 
The cells contain few vacuoles or no vacuoles at all
They are further divided in the following parts
1)Apical meristem
2)Lateral meristem
3)Intercalary meristem
3 0
3 years ago
Read 2 more answers
What can be recycled to form new paper products?
Dima020 [189]

old useful paper that someone threw in the trash

7 0
3 years ago
Read 2 more answers
Help ! will give brainliest!
Vera_Pavlovna [14]
It’s b, biocrusts help the environment
3 0
2 years ago
Other questions:
  • Which of the following is the correct measurement for the volume of liquid shown below?
    12·2 answers
  • What is the name of the stage that precedes both mitosis and meiosis?
    12·1 answer
  • The bicoid (bcd) gene in Drosophila melanogaster has a role in establishing the polarity of the insect larva early in developmen
    9·1 answer
  • Two garden plots were planted with corn. The soil was similar in each, and equal amounts of water were applied to each plot. One
    8·1 answer
  • When paleontologist refer to the "Big Five" to what are they referring?
    9·1 answer
  • The time from one economic peak to another economic peak (think roller coaster ride) is called the _____.
    10·2 answers
  • How did scientists determine SM0313 is the oldest star ever discovered?
    9·2 answers
  • HELP I WILL GIVE BRAINLYEST I NEED A ANSWER QUICK THO!
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Describe the role of bacteria in the nitrogen cycle.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!