1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
13

An electrochemical cell is constructed such that on one side a pure lead electrode is in contact with a solution containing Pb2+

ions at a concentration of 0.002 M. The other cell half consists of a pure nickel electrode that is immersed in a solution of Ni2+ ions having a concentration of 0.4 M. Given that the standard electrode potentials for lead and nickel are -0.126 and -0.250 V, respectively, at what temperature will the potential between the two electrodes be -0.012 V?
Chemistry
1 answer:
Ugo [173]3 years ago
4 0

Answer:

-490.7 K

Explanation:

Given:

[Ni^2+]= 0.4 M

[Pb^2+]=0.002 M

∆V= -0.012 V

VNi= -0.250V

VPb= -0.126V

F= 96500 C

R= 8.314 JK-1 mol-1

n= 2

From

T= -nF/R [∆V-(VNi-VPb)/ln [Pb2+]/[Ni2+]]

T= 2(96500)/8.314[ (-0.012) -(-0.250) - (-0.126))/ln[0.002]/[0.4]

T= 23213.856(0.112/(-5.298))

T= -490.7 K

You might be interested in
Halp balance plez (⊙◡⊙)
grandymaker [24]

Answer: SnO2 + 2 H2 = Sn + 2 H2O

Explanation: I used a balance equation website. It's called WebQC if you want to check it out for future help.

8 0
3 years ago
why is the ability of apple snails to survive an increase in the salinity of water considered an adaptation
masya89 [10]

Apple snails inhabit a wide range of ecosystems from swamps, ditches and ponds to lakes and rivers. The majority of the species prefer lentic water above streaming water and only a few species have adapted to rivers with strong current.


<span>Breathing through the siphon when submerged (<span>Pomacea canaliculata</span>).</span>

The lung/gills combination in apple snails reflects their adaptation to habitats with oxygen poor water. This is often the case in swamps and shallow waters. The without thelung they would completely depend on their gills, which would decrease their ability to survive. 
Another advantage of air breathing in combination with a shell door (operculum) is the ability to survive periods of drought often common in these habitats during the dry season. 

7 0
3 years ago
True or False: Molar ratios come from the molar coefficients of balanced chemical reactions
jeka94

Answer:

1. true

2.true

3.fasle

Explanation:

sorry if im wrong.

have a lovely day.

7 0
3 years ago
Which of the following will have the slowest rate of diffusion at a given temperature?
marysya [2.9K]
<h3>Answer:</h3>

Chlorine gas (Cl₂)

<h3>Explanation:</h3>
  • According to the Graham's law of diffusion, the diffusion rate of a gas is inversely proportional to the square root of its density or molar mass.
  • Therefore, a lighter gas will diffuse faster at a given temperature compared to a heavy gas.
  • Consequently, the heavier a gas is then the denser it is and the slower it diffuses at a given temperature and vice versa.

In this case we are given gases, CI₂

, H₂,He and Ne.

  • We are required to identify the gas that will diffuse at the slowest rate.
  • In other words we are required to determine the heaviest gas.

Looking at the molar mass of the gases given;

Cl₂- 70.91 g/mol

H₂- 2.02 g/mol

He - 4.00 g/mol

Ne- 20.18 g/mol

Therefore, chlorine gas is the heaviest and thus will diffuse at the slowest rate among the choices given.

8 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • What best describes the kinetic energy of two gas particles before and after a collision?
    14·1 answer
  • In a reaction between 1-pentene and cl2, what are the products?
    7·1 answer
  • How many moles of Al(CN)3 are in 183 g of the compound?
    9·1 answer
  • I'LL GIVE U BRAINLIEST
    14·2 answers
  • What else is found on earths atmosphere?
    5·1 answer
  • Calculate the equilibrium concentration of hc2o4− in a 0.20 m solution of oxalic acid.
    12·1 answer
  • If 31.6 g of KMnO4 is dissolved in enough water to give 160 mL of solution, what is the molarity?
    14·1 answer
  • Which of these is an example of light energy being transformed into chemical energy
    8·1 answer
  • Styrofoam is an example of a *<br> Conductor<br> Radiator<br> Insulator<br> Con vector
    10·1 answer
  • What is one way humans can control landfills?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!