1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
3 years ago
13

Which liquid would be the most difficult to raise or lower the temperature of

Chemistry
2 answers:
vaieri [72.5K]3 years ago
7 0
I think it’s A. One with low density
Pavel [41]3 years ago
5 0

Answer:i dont know

Explanation:

You might be interested in
Elements are pure substances made up of _____.
mel-nik [20]
Elements are pure substances made up of molecules
3 0
3 years ago
Read 2 more answers
If it requires 23.4 milliliters of 0.65 molar barium hydroxide to neutralize 42.5 milliliters of nitric acid, solve for the mola
rodikova [14]
Volume Ba(OH)2 = 23.4 mL in liters : 

23.4 / 1000 => 0.0234 L

Molarity  Ba(OH)2 = 0.65 M

Volume HNO3 = 42.5 mL in liters:

42.5 / 1000 => 0.0425 L

number of moles Ba(OH)2 :

n = M x V

n = 0.65 x 0.0234 

n = 0.01521 moles of Ba(OH)2

Mole ratio :

<span>Ba(OH)2 + 2 HNO3 = Ba(NO3)2 + 2 H2O
</span>
1 mole Ba(OH)2 ---------------- 2 moles HNO3
 0.01521 moles ----------------- moles HNO3

moles HNO3 = 0.01521 x 2 / 1

moles HNO3 = 0.03042 / 1

= 0.03042 moles HNO3

Therefore:

M ( HNO3 ) = n / volume ( HNO3 )

M ( HNO3 ) =  0.03042 / 0.0425

M ( HNO3 ) = 0.715 M

5 0
2 years ago
Question number 10 &amp; 11, answer please and thank you
nika2105 [10]

Answer:

molarity = moles of solution/liters of solution

molarity = 1 mole/2 liters

molarity = 0.5 M

molarity = 50 moles/200 kg

molarity = 0.25 M

Explanation:

3 0
3 years ago
Does gasoline (C8H12) have polar or non-polar molecules?
Archy [21]

Answer:

non polar molecules

Explanation:

Ethyl alcohol will dissolve in water in all proportions because the polar molecules interact with each other freely. In contrast, gasoline is a nonpolar molecule.  hope that helped...

3 0
3 years ago
Find the mass of 5.82 mol of MgCl2. Round to the nearest tenth.
Oksana_A [137]

Answer:

554.13 grams

Explanation:

8 0
3 years ago
Other questions:
  • What is the volume of the item described?
    7·1 answer
  • Write a balanced equilibrium equation for the dissolution of nai in water. include phases.
    8·2 answers
  • A solid metal oxide crystallizes in a cubic unit cell. In the unit cell there are metal (M) ions on every corner and in the cent
    12·1 answer
  • Student A pushed on the cart with a force of 500 N. Student B pushed on the other side of the cart. The cart did not move. How m
    13·1 answer
  • What is the formula for aluminum sulfate?
    13·1 answer
  • Which is a substance fruit salad granola cereal spaghetti or table salt
    5·2 answers
  • Which has a higher freezing point, pure water or sea water?
    5·1 answer
  • *CHEMISTRY*
    6·1 answer
  • In N, +0,<br>N,O,, nitrogen is reduced<br>A True<br>B. False​
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!