Answer:
It would be the forest floor.
Explanation:
The forest floor is the lowest level, and therefore is covered by things above it.
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
The P wave of the electrocardiogram is considered as a signal from the DEPOLARIZATION of the atria in the heart. This depolarization drives the contraction of the atrial musculature.
An electrocardiogram (ECG) is a device that records the electrical activity of the heart. This record can then be used to diagnose different heart conditions.
The P waves occur when the sinoatrial node generates an action potential which is capable of depolarizing the atria.
This depolarization is then followed by atrial contraction and an increase of the pressure in the atria.
Learn more in:
brainly.com/question/1569437?referrer=searchResults
Answer: Fish are farmed by breeding them in controlled environments. Kennels sort of. They are huge cages in man-made resivours with temperature and water control. Once they have grown to be a certain size they are extracted and killed for their meat while the eggs are used to produce another batch of fish. Hope this was helpful :).