1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
6

Help please stuck and confused

Chemistry
1 answer:
Alecsey [184]3 years ago
7 0
I’m pretty sure it’s none of the above cause I’m googling it a bunch and and it say you use the dideoxy method
You might be interested in
What is the the term for the final products in a reaction ?
rjkz [21]

Answer:

the final product is called a product

Explanation:

3 0
2 years ago
Are the atoms really "sharing" electrons? Explain.
Iteru [2.4K]

Answer:

yes, in certain cases

there are different types of bondings between atoms

and in some they lend electrons to make their atom stable this type of bonding is called ionic bonding

and in covalent bond the atoms share their electrons

7 0
3 years ago
Light, heat, and ultraviolet radiation are types of ___ produces by stars
Charra [1.4K]

Answer:

energy

Explanation:

Those are all forms of energy

6 0
3 years ago
Fluorine gas reacts with zinc (II) chloride →
dezoksy [38]

Answer:

Zinc Chloride + Difluorine -----> Zinc Fluoride + Dichlorine

Explanation:

ZnCl2 + F2 → ZnF2 + Cl2

5 0
3 years ago
Select all the correct images.<br> Select the atomic models that belong to the same element.
Alex_Xolod [135]

Answer:The 2nd and 3rd one.

Explanation:

It has the same number of protons but different amount of nuetrons.

7 0
2 years ago
Other questions:
  • The normal freezing point of a certain liquidXis0.4°C, but when5.90gof ureaNH22COare dissolved in450.gofX, it is found that the
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many molecules are in 62.01 grams of CO
    15·1 answer
  • What is the definition of force meter
    13·1 answer
  • Susan and her friend found a piece of metal which they want to
    7·1 answer
  • Describe the interactions of the nervous and muscular system. please write a paragraph and do not plagiarize If you need to cite
    15·1 answer
  • The alpha decay of a radioactive nuclide (X) emits a He-4 nucleus and produces an isotope of Superscript 235 subscript 92 upper
    14·1 answer
  • Which of the following is not an example of a chemical change? (hint:
    6·1 answer
  • Please help hehehheh​
    6·1 answer
  • Aqueous hydrochloric acid reacts with solid sodium hydroxide to produce aqueous sodium chloride and liquid water . What is the t
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!