1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kykrilka [37]
3 years ago
15

Write the net ionic equation for the acid-base hydrolysis equilibrium that is established when ammonium perchlorate is dissolved

in water. (Use H3O+ instead of H+.)
Chemistry
1 answer:
Whitepunk [10]3 years ago
5 0

<u>Answer:</u> The net ionic equation is written below.

<u>Explanation:</u>

Net ionic equation of any reaction does not include any spectator ions.

Spectator ions are defined as the ions which do not get involved in the chemical equation. It is also defined as the ions which are found on both the sides of the chemical reaction when it is present in ionic form.

The chemical equation for the reaction of ammonium perchlorate and water is given as:

NH_4ClO_4(aq.)+H_2O(l)\rightarrow NH_4OH(aq.)+HClO_4(aq.)

Ionic form of the above equation follows:

NH_4^+(aq.)+ClO_4^-(aq.)+H_2O(l)\rightarrow NH_4OH(aq.)+H^+(aq.)+ClO_4^-(aq.)

Ammonium hydroxide will not dissociate into its ions because it is a weak base.

As, chlorate ions are present on both the sides of the reaction, thus, it will not be present in the net ionic equation.

The net ionic equation for the above reaction follows:

NH_4^+(aq.)+H_2O(l)\rightarrow NH_3^+(aq.)+H_3O^+(aq.)

Hence, the net ionic equation is given above.

You might be interested in
Why are gold and platinum sutible for making jewellery ? ​
Anon25 [30]

Answer:

Platinum Gold and silver are used to make jewellery because of the following reasons. They are highly lustrous metals which are resistant to corrosion. They are highly malleable and ductile so can be transformed into any shape or design.

Explanation:

6 0
2 years ago
Read 2 more answers
During oxidation what happen
Agata [3.3K]
Oxidation is when a substance gains oxygen molecules. For example when hydrogen reacts with oxygen it forms H₂O. The H₂ has been oxidised.
4 0
3 years ago
3<br>Nitrogen obtained in the laboratory is collected over water.why?​
Cloud [144]
Because displacement of water is the convenient way to obtain gas.
8 0
3 years ago
What is the mass of 0.28 mole of iron?
vredina [299]

Answer:

Your answer should be 15.68 grams.

Explanation:

Seeing as 1 mole has a mass of 56 g, 56*0.28 would get you 15.68 g.

6 0
3 years ago
What is the name of a solution whose concentration of solute is equal to the maximum concentration that is predicted from the so
Alona [7]
Normally, you would call this a saturated solution.<span />
5 0
3 years ago
Other questions:
  • What is a percent volume of ethanol c2h60 in the final solution when 85 ml of it is diluted to a volume?
    8·1 answer
  • Which is the correct order of material in terms of reflectivity from least to greatest
    10·1 answer
  • I WILL MARK BRAINLIEST If the number of crests that pass a point in a given time increases, what has decreased?
    7·2 answers
  • Polymers formed from amino acids are called _____. proteins carbohydrates lipids nucleic acids
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • what is the best description of weathering? A. breakdown of rocks through mechanical or chemical processes. B.when rocks layers
    5·1 answer
  • Which is a base unit used in the metric system? quarts liters pints degrees Fahrenheit
    9·2 answers
  • Why does H2O have a lower melting point than MgO
    6·1 answer
  • How many liters of 2.0 M HCl are required to exactly neutralize 1.5 L of 5.0 M NAOH?
    12·1 answer
  • Елементите от IА и IIА групи на Периодичната система
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!