1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ratling [72]
3 years ago
12

Q What is the volume

Chemistry
2 answers:
Georgia [21]3 years ago
8 0

Answer:

need more information pls

Explanation:

because information is good to know

Vadim26 [7]3 years ago
5 0
What does Q represent ?
You might be interested in
How does adding an atom affect the position of existing atoms or lone pairs?
Paha777 [63]

Adding an atom will increase the repulsion between existing atoms and lone pairs. Added atom will result in bond pair-bond pair and bond pair-lone pair repulsion. The magnitude of the lone pair-bond pair repulsion is greater than the bond pair-bond pair repulsion. The added atom will change the electron geometry and bring about a distortion in the molecular geometry.

8 0
3 years ago
Read 2 more answers
An unspecified ratio of nitrogen gas and hydrogen gas are mixed in a container and then react to form ammonia. the initial mole
Tanzania [10]
<span>The initial mole fraction of the hydrogen gas is the same value as the nitrogen gas due to the fact neither material consumes the other. Because of this equal ratios where mixed initially, with the outcome in volume being the same.</span>
5 0
3 years ago
Which is always true of a salt?
igomit [66]
Third one is correct .
3 0
3 years ago
What is the total oxidation state of the fluorine atoms
Arte-miy333 [17]

Answer:

-1

Explanation:

4 0
3 years ago
An atom of boron has an atomic number of 5 and an atomic mass of 11. The atom contains:. . A. 5 protons, 6 electrons, and 5 neut
Mars2501 [29]
<span>C. 5 protons, 5 electrons, and 6 neutrons</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • If you were making iced tea from a mix (adding powdered iced tea to water) and it tasted too strong, how would you describe this
    13·2 answers
  • Which of the following is an example of a homogeneous mixture?
    13·1 answer
  • How does calcium obey the octet rule when reacting to form compounds?
    6·2 answers
  • Write a balanced half-reaction for the reduction of dichromate ion cr2o−27 to chromium ion cr 3 in basic aqueous solution. be su
    6·2 answers
  • What atom has 19 protons and 20 neutrons
    8·2 answers
  • What is mixture of noodles in a bowl​
    5·1 answer
  • PLEASE HELP: 60 POINTS
    14·2 answers
  • (b)Calculate the number of moles of CuSO4 that were in the impure sample of CuSO4(s) .
    7·1 answer
  • Kate gathered three boxes of the same size made of different materials; glass, clear
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!