1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
3 years ago
6

Which graph shows the probability distribution for the random variable representing the number of greens (green is represented b

y the letter g)
Mathematics
2 answers:
zmey [24]3 years ago
8 0

Answer: Option B

The second chart

Step-by-step explanation:

Did it on edge

Natalka [10]3 years ago
3 0

Answer:

The Second one


You might be interested in
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
4. A TV has a screen that is 15 in. long and has a 25 in. long diagonal. Find
yaroslaw [1]

Answer:’

Step-by-step explanation:

6 0
3 years ago
Helpppp plssss!! Show your work!!<br><br>Thanks
Eduardwww [97]

Slope of a Line Passing through two points (x₁ , y₁) and (x₂ , y₂) is given by :

\heartsuit\;\;Slope(m) = \frac{y_1 - y_2}{x_1 - x_2}

Given Points are (-3 , 5) and (6 , -1)

here x₁ = -3 and x₂ = 6 and y₁ = 5 and y₂ = -1

\heartsuit\;\;Slope(m) = \frac{5 + 1}{-3 - 6} = \frac{6}{-9} = \frac{-2}{3}

Option D is the Answer

4 0
4 years ago
Can you pls slove the 12 question ​
quester [9]
So (77 5/7)/17
5/7 = 0.7142
77.7142/17
=4.5714 rupees per metre
7 0
3 years ago
A prime polynomial cannot be written as a product of lower-degree polynomials. Which polynomial is prime? A)8x2 – 10x – 3 b)8x2
Zanzabum

Answer:

Option (A) and (C).

Step-by-step explanation:

Prime polynomial can't be written as a product of lower degree polynomials.

(A)

8x^2-10x-3

=8x²-6x-4x-3

=2x(4x-3)-1(4x+3)

Here we can't write the polynomial as a product of lower degree.

Therefore it is a prime polynomial.

(B)

8x²+2x-3

=8x²+6x-4x-3

=2x(4x+3)-1(4x+3)

=(4x+3)(2x-1)

Therefore it is not a prime polynomial.

(C)

8x²-6x-3

Therefore it is a prime polynomial.

(D)

8x²+23x-3

=8x²+24x-x-3

=8x(x+3)-1(x+3)

=(x+3)(8x-1)

Therefore it is not a prime polynomial.

5 0
3 years ago
Read 2 more answers
Other questions:
  • A water well drilling rig has dug to a height of –60 meters after one full day of continuous use.a) Assuming the rig drilled at
    8·1 answer
  • Abigail drew 12 hearts and 28 circles. What is the ratio of circles to hearts
    8·1 answer
  • Please help me with #57
    13·1 answer
  • Name
    15·1 answer
  • I dont know how she got her anser pleas help
    9·1 answer
  • Please help fast!!!
    13·2 answers
  • Steve sold 252 fruit basket for a school fundraiser. Evie aold 25 fruit baskets for each 100 baskets that steve sold. How many f
    6·1 answer
  • Graph a system of equations with the solution (-4,6)
    6·1 answer
  • If you flip a coin 10 times ,you would expect to get​
    10·2 answers
  • Write 28 1/4 as a decimal.​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!