Answer:
Fossils are usually named based on the following conditions-
- the location in which they are found
- named after the scientist who discovers it
- the rock formation in which they are found
- They are given two names, the genus and the species
These fossils are again categorized into different groups depending on the similarity in terms of form.
These names of the fossils are important to the comparative anatomists because it helps them in doing the comparative study and understand the causes of similarities and dissimilarities in terms of anatomy and also helps in understanding the evolutionary process of these organisms. For example, the fossil named 'Ida' is the primitive fossil that was found to be almost completely preserved. This fossil helped in comparative studies with other fossil species in a number of ways.
Genes are DNA or RNA, they act as instructions to make molecules called proteins! They are found in chromosomes and there main objective is to carry out information that determines your characteristic traits that are inherited from your parents!
Hope that helps :))
Answer: Several behaviors can be considered as cuts when dealing with a client.
Explanation:
Human beings are social beings, we like to interact with each other, but often these interactions do not always occur in the right way. There are several jobs where people have to have an approach with the client and treat them in the best way, which is part of providing a good service.
Various behaviors are considered as cuts when dealing with a client, one of them is being efficient and friendly. When a client enters the person must show a friendly attitude, which allows the client to express what they need. Efficiency must also be shown at the time of performing the work since a person who is occupying a job is because he is capable of performing the work.
Another behavior that can be considered as cuts when dealing with a client is to listen actively. Many people make the mistake of not actively listening to their customers, which can often cause problems when providing a product or service, or simply listen to the customer's complaints. It is important to make the client feel that he is heard, that what he has to say is important.
Keeping calm in any situation is also a way of being courteous to the client. Each person is different, so not all of them will have the same mood at that time. It is important to remain calm and be professional when dealing with a client. It is not correct to respond inappropriately if the client does so, professionalism must be above all. If a client behaves in a certain way, reporting it might be a good idea, but not reaching the point of using the same tone or way of acting that the client used at the time.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Pericardium or pericardial sac.
Hope This Helps!
