1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
5

How many moles of glucose are present

Chemistry
1 answer:
fomenos3 years ago
6 0

Answer:

Glucose (C6H12O6, M= 180.16 G/mol) [7.8 × 10−3 Moles] = Answer.

Explanation:

You might be interested in
A 1. 07 g sample of a noble gas occupies a volume of 363 ml at 35°c and 678 mmhg. Identify the noble gas in this sample. (r = 0.
Margaret [11]

The identity of the noble gas is the sample is Krypton

<h3>Ideal Gas law</h3>

From the question, we are to determine the identity of the noble gas in the sample

From the ideal gas equation, we have that

PV = nRT

∴ n = PV / RT

Where P is the pressure

V is the volume

n is the number of moles

R is the gas constant

and T is the temperature

From the given information,

P = 678 mmHg = 0.892105 atm

V = 363 mL = 0.363 L

R = 0.08206 L.atm/mol.K

T = 35 °C = 35 + 273.15 K = 308.15 K

Putting the parameters into the equation, we get

n = (0.892105 × 0.363)/ (0.08206 × 308.15)

n = 0.0128 moles

Now, we will determine the Atomic mass of the sample

Using the formula,

Atomic = Mass / Number of moles

Atomic mass of the substance = 1.07 / 0.0128

Atomic mass of the substance = 83.6 amu

The noble gas with the closest atomic mass to this value is Krypton.

Molar mass of Krypton = 83.798 amu

Hence, the identity of the noble gas is the sample is Krypton

Learn more on Ideal Gas law here: brainly.com/question/20212888

#SPJ12

4 0
2 years ago
How many neutrons does a atom of cobalt have?
OverLord2011 [107]

Did you mean the atomic mass?


4 0
3 years ago
What is the charge on an atom after it gains two electrons during the formation of a bond?
vekshin1

Answer:

two negative charges is the answer of your question

8 0
2 years ago
How many grams is 4.15 liters of O2 at stp?
RSB [31]

Answer:

Mass = 5.92 g

Explanation:

Given data:

Volume of O₂ = 4.15 mol

Temperature and pressure = standard

Mass in gram = ?

Solution:

The given problem will be solve by using general gas equation,

PV = nRT

P= Pressure

V = volume

n = number of moles

R = general gas constant = 0.0821 atm.L/ mol.K  

T = temperature in kelvin

By putting values,

1 atm × 4.15L = n ×0.0821 atm.L /mol.K × 273.15 k

4.15 atm.L = n ×22.43 atm.L /mol

n = 4.15 atm.L / 22.43 atm.L /mol

n = 0.185 mol

Mass in gram:

Mas = number of moles × molar mass

Mass = 0.185 mol ×32g/mol

Mass = 5.92 g

3 0
2 years ago
A cube of iron at 20C is placed in contact with a cube of copper at 60C. Which statement describes the initial flow of heat betw
Anestetic [448]

Answer:

the iron is more condensed then the copper more electricity

7 0
2 years ago
Other questions:
  • Explain how you determine the number of valence electrons that should be used in the dot structure for silicon dioxide and state
    14·1 answer
  • How many moles of water will be generated during the combustion of 0.38 moles of methyl alcohol (CH3OH)? 2CH3OH + 3O2 2CO2 + 4H2
    14·1 answer
  • A microscope containing two or more lenses is an
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is the mass in grams of 6.022×1023 atoms of mass 16.00 amu?
    5·1 answer
  • Describe what happens to the mass number and the atomic number of a nuclide during alpha decay.
    12·2 answers
  • Many of the stars we see in the night sky are called blue giants. They put out more energy and burn millions of times brighter t
    10·1 answer
  • Is orange juice a element or a mixture
    5·2 answers
  • Reaction B could produce a substance with a pH of...<br><br> 14.<br><br> 4.<br><br> 10.<br><br> 7.
    5·2 answers
  • When the head of a match burns, chemical reaction is taking place. But a certain amount of energy is required to get this reacti
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!