1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
10

Which part of the cell does this illustration represent?

Biology
2 answers:
bonufazy [111]3 years ago
7 0
It is the structure of a Mitochondria.

:)
VashaNatasha [74]3 years ago
4 0

The right answer is Mitochondria.

Mitochondria are limited by two membranes with very different properties:

* The outer membrane is low in protein and contains a transmembrane protein, porin, which allows the passage of ions and water-soluble metabolites of molar mass <10,000 Da.

* In contrast, the inner membrane is very rich in proteins but it is almost impermeable to ions and water-soluble metabolites. These substances can only cross the membrane using transport membrane proteins (ATP, ADP and Pi are transported by this type of protein) or by more sophisticated mechanisms called shuttle.

* The space between these two membranes is called the intermembrane space.

You might be interested in
About 40 percent of the medicines used in the United States are derived from _____.
tester [92]
The answer would be, "C", "Plants". 
4 0
3 years ago
Read 2 more answers
4. A soda can has a volume of 0.35 liters and before opened its internal pressure is 30 psi. What
777dan777 [17]

The volume of the gas expansion is 0.71 liters.

<h3>Boyle's law</h3>

Boyle's law states that the volume of a given mass of a gas is inversely proportional to its pressure provided that temperature remains constant.

P₁V₁ = P₂V₂

where;

  • P₁ = 30 psi
  • V₁ = 0.35 liters
  • P₂ = 1 atm = 14.7 psi

The volume of the gas expansion is calculated as follows;

V_2 = \frac{P_1 V_1}{P_2} \\\\V_2 = \frac{30 \times 0.35}{14.7} \\\\V_2 = 0.71 \ Liters

Learn more about Boyle's law here: brainly.com/question/469270

7 0
3 years ago
Which of the following is not necessary for a plant to carry out photosynthesis?
ss7ja [257]
The answer is c. oxygen
4 0
3 years ago
Read 2 more answers
Which part of the cell cycle last longer
kondaur [170]
Interphase is the longest part of the cell cycle. This is when the cell grows and copies its DNA before moving into mitosis.
6 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Other questions:
  • At which station is precipitation most likely occurring at the present time
    7·1 answer
  • In transcription, _____ is used as a template for the construction of a new rna molecule.
    7·1 answer
  • Do small cells have a large surface area
    10·2 answers
  • How can the mass of an object be determined in a laboratory?
    14·1 answer
  • A plant cell has a versatile compartment that stores organic nutrients, absorbs water, and contains poisons that protect against
    5·1 answer
  • Which of the following contains the greatest number of totipotent stem cells?
    7·2 answers
  • Which of the following involves pathogens or an invading viruses or bacteria
    12·2 answers
  • What an animal uses for food is part of its:
    11·1 answer
  • Geysers are eruptions of hot water from the ground. Geysers are usually found in areas of volcanic activity. The heat required t
    10·1 answer
  • In a plant what is formed by a group of xylem vessels<br>A an oragan<br>B tissue<br>C organ system​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!