1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
10

Which form of co2 transport accounts for the greatest amount of co2 transported in blood?

Chemistry
1 answer:
ra1l [238]3 years ago
5 0
The greatest amount of CO2 transported in blood is in the form of bicarbonate in plasma. Most of the carbon dioxide is converted into bicarbonate with the help of carbonic anhydrase which is an enzyme. This enzyme converts carborn dioxide and water into bicarbonate and hydrogen ions. The bicarbonate in plasma accounts for about 70% of CO2.
You might be interested in
How many square centimeters are in an area of 8.50 inch^2
Paha777 [63]

Explanation:

Given parameters:

  Dimension = 8.5in²

we are to convert from in² to cm²

 in² = in x in

 cm² = cm x cm

   1 in = 2.54cm

Using dimensional analysis;

   8.5in² x \frac{2.54cm}{1in}  x \frac{2.54cm}{1in}

        =  54.84cm²

We solved this problem using dimensional analysis where we multiplied the unit with 1.

learn more:

Conversion brainly.com/question/555814

#learnwithBrainly

5 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
2 years ago
"Give an explanation of the combustion reaction of octane."
SIZIF [17.4K]

Thus we can balance the oxygen atoms by putting a prefix of 25/2 on the left side. To obtain a equation containing whole numbers, we multiply the entire equation by 2. This gives the final equation. 2 C8H18 + 25 O2 ---> 16 CO2 +18 H2O.

6 0
3 years ago
Include a map with points where neon can be found.
nalin [4]
Here is some information: "Neon is a chemical element with symbol Ne and atomic number 10. It is in group 18 of the periodic table. Neon is a colorless, odorless, inert monatomic gas under standard conditions, with about two-thirds the density of air. It was discovered in 1898 as one of the three residual rare inert elements remaining in dry air, after nitrogen, oxygen, argon and carbon dioxide were removed. Neon was the second of these three rare gases to be discovered, and was immediately recognized as a new element from its bright red emission spectrum. The name neon is derived from the Greek word, νέον, neuter singular form of νέος, meaning new. Neon is chemically inert and forms no uncharged chemical compounds. The compounds of neon include ionic molecules, molecules held together by van der Waals forces and clathrates."

Also: "Neon is rare on Earth, found in the Earth's atmosphere at 1 part in 55,000, or 18.2 ppm by volume (this is about the same as the molecule or mole fraction), or 1 part in 79,000 of air by mass."

Also I only found one if that is okay but here it is: It is the place where it is a city and most people find most neon there.

5 0
3 years ago
Using the periodic table, choose the more reactive metal. Ta or V Ta​
Jlenok [28]

Answer:

V Ta is more reactive, hope this helps!

8 0
2 years ago
Other questions:
  • Hydrogen bonds between water molecules are responsible for the unique chemical and physical properties of water. True False
    6·1 answer
  • There is a "short-cut" to determining the number of valence electrons. how can you determine the number of valence electrons by
    15·1 answer
  • The area of the circular base of a can of
    12·1 answer
  • Soils are made up of a mineral portion, an organic portion, air and water. What is meant by the
    7·1 answer
  • The process of removal of oxygen in a chemical reaction is called?
    10·2 answers
  • Zinc is more active than cobalt and iron but less active than aluminum. Cobalt is more active than nickel but less active than i
    12·1 answer
  • Which substance is a polymer found in nature?<br> O carpet<br> O cotton<br> O paint<br> O nylon
    10·2 answers
  • What does percent composition tell you about a substance
    11·2 answers
  • A gas with a volume of 4.0L at a pressure of 205kPa is allowed to expand to a volume of 12.0L. What is the pressure in the conta
    11·1 answer
  • Which substance combines with iron in the presence of water to form rust?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!