Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Melting butter
Explanation:
You can reverse the change of butter back to its original state but you can never reverse the rest back to there original state
Answer:
HOAc is stronger acid than HClO
ClO⁻ is stronger conjugate base than OAc⁻
Kb(OAc⁻) = 5.5 x 10⁻¹⁰
Kb(ClO⁻) = 3.3 x 10⁻⁷
Explanation:
Assume 0.10M HOAc => H⁺ + OAc⁻ with Ka = 1.8 x 10⁻⁵
=> [H⁺] = √Ka·[Acid] =√(1.8 x 10⁻⁵)(0.10) M = 1.3 x 10⁻³M H⁺
Assume 0.10M HClO => H⁺ + ClO⁻ with Ka = 3 x 10⁻⁸
=> [H⁺] = √(3 x 10⁻⁸)(0.10)M = 5.47 x 10⁻⁵M H⁺
HOAc delivers more H⁺ than HClO and is more acidic.
Kb = Kw/Ka, Kw = 1 x 10⁻¹⁴
Kb(OAc⁻) = 5.5 x 10⁻¹⁰
Kb(ClO⁻) = 3.3 x 10⁻⁷
It can possible be you're arteries or also you're intestines with is large and small.
