1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
4 years ago
15

A geologist uses chronological order to _____

Biology
1 answer:
BabaBlast [244]4 years ago
4 0

Answer: The answer is a geologist uses chronological order to examine how different cultures are  formed and changed.

Explanation: Chronological order means arranging events in the order they occurred or happened. It means details of events as they happened.  It is also referred to as the details of how things happened.

Chronological order is also said to be arranging events in the order of time.

You might be interested in
Which of the following lists, in correct order, the phases of interphase? View Available Hint(s) G1, A) prophase, and S Prophase
Lady_Fox [76]

Answer:

G1 - S - G2 (may be is option D)

Explanation:

The interface begins with phase G1 where the cell increases its volume and the mass is doubled.

Then, we continue with the S phase where DNA and histones are synthesized.

Afterwardsy we reach the G2 phase where the chromosomes are duplicated.

Finally we reach, the begining of mitosis.

5 0
3 years ago
Which factor has greatest importance in determining the characteristics of an aquatic ecosystem
Katarina [22]
"Water depth" is the factor among the choices given that has the <span>greatest importance in determining the characteristics of an aquatic ecosystem. The correct option among all the options given is the second option.
</span>
3 0
4 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Water availability poses the single greatest limitation to plant life in deserts. The amount of moisture that is available for p
svetoff [14.1K]
I might be incorrect, but from what I remember it should be particle size
6 0
3 years ago
What percentage of water on Earth is considered freshwater?<br> A. 2%<br> B. 3%<br> C. 4%<br> D. 5%
MrRissso [65]
B. only 3% of water on earth is fresh
4 0
3 years ago
Other questions:
  • What is the answer ?
    13·1 answer
  • Henry eats rice for lunch, which contains starch. Which enzyme catalyzes the reaction that takes place and which product is the
    12·2 answers
  • What is the role of the beaver in its ecosystem?
    11·1 answer
  • A mineral forms from water at the edge of a lake. Which statement best describes this mineral? The mineral formed from lava. The
    10·2 answers
  • A widow’s peak is a human trait that is controlled by a single gene. 7. a male inherits two x chromosomes. 8. a karyotype tracks
    11·1 answer
  • Define monomer and polymer
    7·2 answers
  • A geologist notices that the land on one side of a break in the crust is slightly higher than the other side. What has the geolo
    7·2 answers
  • Viruses act like they are part of your body,attaching to a cell and injecting its genetic material into the cell.The cell doesn'
    5·1 answer
  • Jaden grows geraniums in his greenhouse. He has noticed that his flowers are not growing very well. The greenhouse is in the sha
    13·1 answer
  • What are the astronauts doing in the opening scene when storm arrives ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!