1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlladinOne [14]
3 years ago
5

UITIVEise dlu

Biology
1 answer:
Roman55 [17]3 years ago
6 0

Answer:

14 bilion years old

Explanation:

You might be interested in
Complete the following vocabulary exercise related to the process of translation of mRNA to protein by the ribosome.Match the wo
vredina [299]

1. The RNA that has an amino acid attached to it, and that binds to the codon on the mRNA, is called a tRNA.

tRNA are molecules involved in protein synthesis (translation) and those molecules connect codons from mRNA with  the amino acids they encode.tRNA has anticodone that binds to mRNA codone.

2. The process, performed by the ribosome, of reading mRNA and synthesizing a protein is called translation.

Translation is a process of gene expression in which proteins are synthesized (translated from the codons on mRNA).

3. Initiation of translation always happens at the start codon of the mRNA.

Translation process can be divided into three stages: initiation (starting off), elongation (adding amino acids to peptide chain that is going to become protein) and termination (finishing up).

4. Amino acids are attached to tRNA by enzymes called aminoacyl-tRNA synthetase.

These enzymes are part of the elongation stage of translation and they catalyze the adding of amino acids.

5. Termination of translation happens when the ribosome hits a stop codon on the mRNA.

Termination is the stage in which the finished polypeptide chain (future protein) is released from the ribosome.

5 0
3 years ago
Read 2 more answers
How is a mitochondria’s structure related to its function
pashok25 [27]

It is because it's surface area is responsible for the production of ATP molecules.

8 0
4 years ago
What happens in meiosis during telophase ii
Zepler [3.9K]
During telophase II, the fourth step of meiosis II, the chromosomes reach opposite poles, cytokinesis occurs, the two cells produced by meiosis I divide to form four haploid daughter cells, and nuclear envelopes (white in the diagram at right) form.
7 0
3 years ago
Most body cells undergo mitosis, but there are a couple of tissues in the body whose cells do not. Name one of those types of ce
Alinara [238K]

Answer:

Adult stem cells

Explanation:  Some very specialized somatic cells such as cardiac muscle cells, nerve cells, and red blood cells do not undergo mitosis.

6 0
3 years ago
A scientist repeats another scientist's experiment but guts different results. What are possible causes
Pachacha [2.7K]
If the results of an experiment have different conclusions, something must have changed. these are called **variables**. if more than one variable is changed, the result would be different. because the total conclusion is different, it is a hypothesis, because it is not universally true.
4 0
3 years ago
Other questions:
  • In the steps of the scientific method, what is the next step after formultating and objectively testing hypotheses
    9·1 answer
  • What is the difference between a cell, a tissue, an organ, and a system in an animals body
    5·1 answer
  • Show how an atom looks like a solar system
    14·1 answer
  • This is a __________ reaction and the product(s) is/are A) replacement; aluminum. B) decomposition; oxygen. C) synthesis; alumin
    12·2 answers
  • Jayden used the multiplication table below to determine that 8:14 is equivalent to 24:42​
    14·1 answer
  • Which of the following is true?
    14·1 answer
  • PLEASEEE ANSWERR !!!​
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • In a eukaryotic cell, where is most of the dna located?
    14·1 answer
  • What are organisms that make their own food called?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!