1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly [62]
2 years ago
14

At 2000°C, the equilibrium constant for the reaction below is Kc = 4.10 ´ 10–4 . If 0.600 moles of NO is placed in a 1.0-L react

ion vessel, what will the equilibrium concentration of N2 be?
Chemistry
1 answer:
erastova [34]2 years ago
3 0

Answer:

At equilibrium, the concentration of N_{2 (g)} is going to be 0.30M

Explanation:

We first need the reaction.

With the information given we can assume that is:

N_{2 (g)} + O_{2 (g)} ⇄ 2NO_{(g)}

If there is placed 0.600 moles of NO in a 1.0-L vessel, we have a initial concentration of 0.60 M NO; and no N_{2 (g)} nor  O_{2 (g)} present. Immediately, N_{2 (g)} andO_{2 (g)} are going to be produced until equilibrium is reached.

By the ICE (initial, change, equilibrium) analysis:

I: [N_{2 (g)}]=0   ;     [O_{2 (g)} ]= 0    ; [NO_{(g)}]=0.60M

C: [N_{2 (g)}]=+x   ;     [O_{2 (g)} ]= +x    ; [NO_{(g)}]=-2x

E: [N_{2 (g)}]=0+x   ;     [O_{2 (g)} ]= 0+x   ; [NO_{(g)}]=0.60-2x

Now we can use the constant information:

K_{c}=\frac{[products]^{stoichiometric coefficient} }{[reactants]^{stoichiometric coefficient} }

4.10* 10^{-4} =\frac{(0.60-2x)^{2}}{(x)*(x)}

4.10* 10^{-4}= \frac{(0.60-2x)^{2}}{x^{2} }

4.10* 10^{-4} * x^{2}= (0.60-2x)^{2}}

\sqrt{4.10* 10^{-4} * x^{2}}= \sqrt{(0.60-2x)^{2}}}

0.0202 x =0.60 - 2x

2x+0.0202x=0.60

x=\frac{0.60}{2.0202}= 0.30

At equilibrium, the concentration of N_{2 (g)} is going to be 0.30M

You might be interested in
Which statement about climate is true?
Y_Kistochka [10]
I believe the answer is B!
6 0
3 years ago
How does an atom become an atom of another element is
ivann1987 [24]
Can you give me the anwsers

3 0
3 years ago
Which biome contains mostly coniferous trees and receives 35 to 100 cm of rain per year?
fredd [130]

Answer: The Taiga Forest

Explanation: I just took the test on e2020

7 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
What is the relationship between concentration and rate of reaction?
marshall27 [118]

Explanation:

<em>The</em><em> </em><em>answer</em><em> </em><em>is</em><em> </em><em>directly</em><em> </em><em>proportional</em><em>, </em><em>because</em><em> </em><em>when</em><em> </em><em>there</em><em> </em><em>is</em><em> </em><em>more</em><em> </em><em>concentration</em><em> </em><em>their</em><em> </em><em>will</em><em> </em><em>more</em><em> </em><em>reactants</em><em> </em><em>to</em><em> </em><em>react</em><em> </em><em>fast</em><em> </em><em>diring</em><em> </em><em>the</em><em> </em><em>chemical</em><em> </em><em>reaction</em><em> </em><em>which</em><em> </em><em>increases</em><em> </em><em>the</em><em> </em><em>rate</em><em> </em><em>of</em><em> </em><em>chemical</em><em> </em><em>reaction</em><em>. </em>

<em>So</em><em>,</em><em> </em><em>we</em><em> </em><em>can</em><em> </em><em>state</em><em> </em><em>that</em><em> </em><em>the</em><em> </em><em>relationship</em><em> </em><em>between</em><em> </em><em>them</em><em> </em><em>are</em><em> </em><em>directly</em><em> </em><em>proportional</em><em>. </em>

<em><u>Hope</u></em><em><u> </u></em><em><u>it helps</u></em><em><u>.</u></em><em><u>.</u></em><em><u>.</u></em>

4 0
3 years ago
Other questions:
  • What is the difference between an ion and an isotope?
    12·1 answer
  • A gas cylinder contains exactly 15 moles of oxygen gas (O2) how many molecules of oxygen are in a cylinder
    8·2 answers
  • Which statement best describes the properties of ionic compounds? They are brittle, solid at room temperature, and have a high m
    11·2 answers
  • NO<br> Assign oxidation numbers to each element in this compound.
    9·1 answer
  • Separate this redox reaction into its component half-reactions. 3o2 4co
    9·1 answer
  • Gas law questions 2-5. Will give brainliest.
    12·1 answer
  • Which products are the same in both the copper carbonate and the calcium carbonate reactions shown above
    8·1 answer
  • Think of the different types of reactions you have learned about. How can you tell if they absorb energy or release energy, and
    13·1 answer
  • What can lead to being curious and also lead to fascinating scientific investigations? a. Questions b. Answers c. Qualitative Me
    13·1 answer
  • If carbon has the electron configuration of (2,4) what would the electron configuration of the element to the right of it on the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!