1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
12

What did cyanobacteria produce that made life possible?

Biology
1 answer:
Ira Lisetskai [31]3 years ago
5 0

Answer:

oxygen

Explanation:

The answer is tiny organisms known as cyanobacteria, or blue-green algae. These microbes conduct photosynthesis: using sunshine, water and carbon dioxide to produce carbohydrates and, yes, oxygen

You might be interested in
Suppose that a batch of controlled-release pills intended to be taken every 12 hours were accidentally manufactured without thei
mr_godi [17]

Answer:Nothing would happen

Explanation:

6 0
3 years ago
Which of the following is NOT a characteristic of a cinder come?
AlladinOne [14]

D. Made of ash and pieces of rock rich in silica.

Should be your answer!

4 0
3 years ago
Read 2 more answers
What is a Haploid cell?
Margarita [4]

Answer:

the first answer that is there a cell with half the chromosome number of the parent cell

5 0
3 years ago
Which of the following water samples would be considered acidic?
Schach [20]
7 is neutral but the ones that would be considered acidic is B
3 0
3 years ago
Read 2 more answers
If someone had the list of your traits you provided in question 1,do you think he or she would be able to find youin a group of
nignag [31]

Answer:

He won't. humans are unique.

Explanation:

DNA holds all the knowledge for your physical traits, which are basically protein-determined. Therefore, DNA has the protein-making instructions. Within DNA, a gene encodes each protein. The sequence of nucleotides in a genome precisely determines the order and forms of amino acid.

DNA----RNA-----PROTEIN

5 0
3 years ago
Other questions:
  • Which of the following is a rock created when a comet dies near the sun due to the evaporation of its water and ice particles?
    14·2 answers
  • Why doesn't crossing over happen in mitosis?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • a mutation in a triplet code that ends up coding for the same amino acid is referred to as a silent mutation. in what sense is i
    15·1 answer
  • What factor of phylogenies enable us to determine that all terrestrial mammals are quadrupedal (walk on all four legs) except hu
    7·1 answer
  • What is life and how are living things organized
    6·1 answer
  • Bdofneocnfo coebfle fonrfjw f. e r e d d d d. f d f g d f d f d f f
    11·1 answer
  • If enzymes are made up of proteins, then can proteins be considered as monomers to enzymes?
    10·1 answer
  • Which statement is NOT true of mitosis?
    6·1 answer
  • During what geologic epoch did the last glacial advance occur?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!