1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Annette [7]
3 years ago
8

When you add water to calcium oxide it makes calcium hydroxide

Chemistry
1 answer:
Romashka [77]3 years ago
7 0
Yes you add water to calcium oxide it makes calcium hydroxide
You might be interested in
A macromolecule made up of mainly carbon and hydrogen atoms that is primarily used for energy storage and in cell membranes.
Alex787 [66]
I believe the answer is glucose
3 0
3 years ago
Read 2 more answers
A solution is prepared by dissolving 0.23 mol of chloroacetic acid and 0.27 mol of sodium chloroacetate in water sufficient to y
Sergio [31]

Answer:

c. chloroacetate ion

Explanation:

The chloroacetic acid, ClCH₂CO₂H, is a weak acid with Ka = 1.36x10⁻³. When this weak acid is in solution with its conjugate base, ClCH₂CO₂⁻ (From sodium chloroacetate) a buffer is produced. The addition of a strong acid as the HCl produce the following reaction

HCl + ClCH₂CO₂⁻ → ClCH₂CO₂H + Cl⁻.

Where the acid reacts with the chloroacetate ion to produce more chloroacetic acid

That means, the HCl reacts with the chloroacetate ion present in the buffer solution

Right answer is:

<h3>c. chloroacetate ion</h3>
8 0
3 years ago
Pls help I’m in a test plssss
____ [38]

Answer:

6

Explanation:

6

5 0
3 years ago
Please help! i will mark as brainliest
beks73 [17]

Answer:

Most of the food energy that enters a trophic level is "lost" as heat when it is used by organisms to power the normal activities of life. Thus, the higher the trophic level on the pyramid, the lower the amount of available energy.

Explanation:

8 0
2 years ago
Read 2 more answers
When a substance melts it is said to go through all of the following except:
Alex Ar [27]
C. Chemical change because it doesn’t change it chemical makeup but it will change temps it’s physical appearance and phase change or change of state
4 0
3 years ago
Read 2 more answers
Other questions:
  • Balance the following equation. Then determine the ratio for the products KCl and O2 generated during the decomposition of potas
    8·2 answers
  • 0.000068 g Express your answer as an integer.
    11·2 answers
  • Atoms of elements at the top of a group on the periodic table are smaller than the atoms of elements at the bottom of the group.
    10·2 answers
  • Please answer!! I WILL GIVE EXTRA POINTS AND BRAINLIEST
    6·2 answers
  • When a drawing made with a black marker gets wet, the marker bleeds and more separates into several colors. What method of separ
    9·2 answers
  • Which of the following elements have the same valence electrons as germanium
    6·1 answer
  • how many moles of water will be produced from the complete combustion of 24.6 moles of ethane according to the following reactio
    7·1 answer
  • Finding the pH for [H+] = 9.4 * 10-3 M?
    15·1 answer
  • What is water (H2O)? Select all that apply * an element a molecule 1 hydrogen and 2 oxygen 2 hydrogen and 1 oxygen
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!