1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
12

The process by which natural forces move weathered rock and soil brim one place to another is called

Biology
1 answer:
xenn [34]3 years ago
8 0

The process by which natural forces move weathered rock and soil from one place to another is called erosion.

You might be interested in
Is mitochondria a plant cell animal cell or both
OleMash [197]
Both plant and animal cells have mitochondria
5 0
3 years ago
Read 2 more answers
When a dna molecule is replicated, the daughter molecules contain one strand of parental dna and one strand of newly synthesized
mezya [45]
It is called <span>semiconservative replication.</span>
5 0
3 years ago
For both actin and microtubule polymerization, nucleotide hydrolysis is important for ______. Group of answer choices promoting
jarptica [38.1K]

Answer:

For both actin and microtubule polymerization, nucleotide hydrolysis is important for decreasing the binding strength between subunits on filaments.

Explanation:

Cytoskeletal filaments are common to eucaryotic cells and are impotartant to the spatial organization of cells. Intermediate filaments provide mechanical strength and resistance to shear stress. Microtubules determine the positions of membrane-enclosed organelles and direct intracellular transport. Actin filaments determine the shape of the cell's surface and are necessary for whole-cell locomotion. A large number of accessory proteins are present that link the filaments to other cell components, as well as to each other. Accessory proteins are essential for the assembly of the cytoskeletal filaments in particular locations, and it includes the motor proteins that either move organelles along the filaments or move the filaments themselves.

Actin filaments and microtubules are assembled with expenditure of energy i.e the ATP/GTP tightly bound to actin/tubulin is irreversibly hydrolyzed to ADP/GTP during the assembly process, and liberation of Pi in the medium occurs subsequent to the incorporation of subunits in the polymer. Pi release acts as a switch, causing the destabilization of protein-protein interactions in the polymer, therefore regulating the dynamics of these fibres. The progress is made in four areas: the chemistry of the NTPase reaction; the structure of the intermediates in nucleotide hydrolysis and the nature of the conformational switch; the regulation of parameters involved in dynamic instability of microtubules; and the possible involvement of nucleotide hydrolysis in the macroscopic organization of these polymers in highly concentrated solutions, compared with the simple case of a equilibrium polymers.  

4 0
3 years ago
i am confused on atoms.. can you help? ​*for some reason they don't have science.. so i chose what my question related to".
Helen [10]

Answer:

The term "atom" is from the Greek word for 'indivisible',atoms are the smallest things in the matter that ould not be divided

Atoms consist of a nucleus made of protons and neutrons orbited by electrons.

Atoms are the basic units of matter and the defining structure of elements.

5 0
3 years ago
Read 2 more answers
30 points will mark brainliest pls hurry
Lerok [7]

Answer:

Food refers to any nutritious substance whereas diet refers to the food eaten by organisms daily.

2,110 calories.

Explanation:

1. Food refers to any nutritious substance that an organisms eat in order to survive and maintain growth whereas diet refers to the sum of food that is consumed by an organism.

2. Malnutrition refers to a condition that occurs from eating a diet which does not supply a healthy amount of nutrients to our body whereas hunger refers to a feeling of discomfort that is caused by lack of food.

3. No, it is not possible to be over-nourished and under-nourished at the same time because a person can attain one condition at a time whether he can be over-nourished or under-nourished.

4. The three elements of food security are availability, access and consumption of food. Availability of food means having sufficient quantities of nutritive food available to a person, access means having sufficient resources to have access to the food and consumption means having taking sufficient amount of nutrients and the ability to absorb and use nutrients in the body.

5. 2,110 calories are taken by consuming 345g of carbohydrate, 80 g of protein, 45g of fat and 12g of alcohol.

4 0
3 years ago
Other questions:
  • What would happen if you removed a level from the levels of organization?
    12·1 answer
  • Which of the following organism are prokaryotes
    14·2 answers
  • Identify the isolation mechanisms described using the drop-down menus. Differences in courtship or other behaviors prevent matin
    5·2 answers
  • How would the karyotype of an organism that reproduces?
    15·1 answer
  • STOP IGNORING ME Which is true regarding all X-linked disorders?
    8·2 answers
  • What cell is best at storing food for a plant
    15·1 answer
  • Which describes a worm that breaks down the bodies of dead organisms?
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If a person had A blood type, then the antigen found on the RBC would be_____.
    7·1 answer
  • Which item is a carbon sink?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!