1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iVinArrow [24]
3 years ago
15

Why don't scientists stop with the first step in the Scientific Method, making observations?

Biology
2 answers:
denpristay [2]3 years ago
5 0
They do not stop because it is a very crucial step to make a hypothesis.
Artyom0805 [142]3 years ago
3 0

Answer: Scientists don't stop with the first step of their experiment because they want other scientists' opinions and that's because they may not trust their own observations. Scientists don't stop with the first step of their experiment also because they would rather plan and run experiments than just observe the world around them.

Explanation: yw plz mark brainliest (:

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Inang<br>mukaangaana<br>wa<br>men<br>CARA<br>mwen<br>Stible<br>ther<br>Macaman<br>wa<br>ut​
Drupady [299]

Answer:

.........................

Explanation:

.................

3 0
3 years ago
Read 2 more answers
Which of the following is an advantage of biomass as an energy source?
Tju [1.3M]

Answer:

a

Explanation:

7 0
3 years ago
Pick a disease such as Multiple Sclerosis or Cerebral Palsey to be overcome.
KonstantinChe [14]

Answer:

a

Explanation:

8 0
4 years ago
Top-level predators help keep the number of many species in balance. These predators would belong to which group? A. invasive sp
Harrizon [31]
  • keystone species is the correct answer.

<u>keystone species</u> which keeps the number of other animal population in

control and low in the entire ecosystem. They play an important role

through this process and helps the food chain effectively.

dominant species - most common species; found often in the ecosystem.

invasive species - which fights for itself survival and can cause harm to

ecosystem. non-native to an ecosystem

4 0
3 years ago
Other questions:
  • A dog breeder wants to show prospective buyers that his dogs are pure breed.which kind of model could he use
    7·1 answer
  • The genetic code is a sequence of DNA nucleotides. In eukaryotic cells, the DNA is located in the nuclei of the cells. The genet
    13·1 answer
  • Which statement describes scientific studies about fossil fuels that are related to politics
    8·1 answer
  • Why is the Circum-Pacific belt shown on this map called the Ring of Fire?
    5·1 answer
  • Which is the planet that is most similar to earth
    13·1 answer
  • When skin cells have third-degree burns, skin grafts are used. What is the benefit to using skin grafts?
    7·2 answers
  • What happens to sister chromatids in meiosis II? *
    8·1 answer
  • Which of the following accurately pairs the phase of the cell cycle with its primary purpose?
    14·1 answer
  • What is the g1 phase
    11·1 answer
  • Which part of the neuron sends messages to other neurons by receiving an action potential and then opening
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!